Check patentability & draft patents in minutes with Patsnap Eureka AI!

Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer

A molecular marker, Angiostrongylia nematode technology, applied in the field of biology, can solve problems such as non-identity, and achieve the effects of reducing clinical symptoms, improving social and economic benefits, and early treatment

Active Publication Date: 2014-04-02
SUN YAT SEN UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although microRNA has a high degree of conservation among various species, that is, the sequences of different species are similar, but not identical

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer
  • Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Primer design

[0030] The sequence of Angiostrongylus cantonensis-derived miR-146a-5p (aca-miR-146a-5p) was retrieved from the microRNA database mirbase as SEQ ID NO: 1 (UGAGAACUGAAUUCCAUAGGC).

[0031] Design of reverse transcription primer with stem-loop SEQ ID NO: 2: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCCTATGG

[0032] The upstream and downstream primers for real-time PCR are:

[0033] Upstream primer SEQ ID NO: 3: ACACTCCAGCTGGGTGAGAACTGAATTCC

[0034] Downstream primer SEQ ID NO: 4: TGGTGTCGTGGAGTCG

Embodiment 2

[0036] Extraction of total RNA from serum or cerebrospinal fluid

[0037] Take 200 microliters of serum or cerebrospinal fluid into an RNase-free EP tube, centrifuge at 12,000 rpm at 4°C for 10 minutes, transfer the supernatant to another RNase-free EP tube, add 1 ml of trizol, shake vigorously for five minutes, and add Chlorane 200 Microliter, mix well and let stand at room temperature for ten minutes, centrifuge at 12000rpm at 4°C for 15 minutes, transfer the supernatant to another RNase EP tube, add an equal volume of isopropanol, mix and let stand at room temperature for 15 minutes, Then put it at 4°C for 35 minutes, centrifuge at 12000rpm at 4°C for 10 minutes, pour off the supernatant, wash the precipitate with 75% ethanol, centrifuge at 7200rpm at 4°C for 10 minutes, discard and air dry for 10 minutes before adding 20 μl of depc-treated water was used to dissolve the precipitate.

Embodiment 3

[0039]Brain lesions caused by Angiostrongylus cantonensis need to be differentiated from viral meningoencephalitis, tuberculous meningoencephalitis and other brain parasitic diseases: 30 patients with confirmed Angiostrongylus cantonensis infection and 30 cases in the control group (viral meningoencephalitis) Meningoencephalitis, tuberculous meningoencephalitis and other brain parasitic disease patients (10 cases each) lumbar puncture to obtain about one milliliter of cerebrospinal fluid, extract RNA according to the method provided in Example 2, reverse transcribe into cDNA, and then perform real-time quantitative fluorescent PCR , the reaction conditions of real-time fluorescent quantitative PCR are: pre-denaturation 95°C, time 10min; denaturation 95°C, time 15sec, annealing temperature 60°C, time 30sec, extension temperature 72°C, time 15sec, cycle number 40 ;Each sample is tested in multiple wells, and each detection reaction needs to be analyzed by melting curve immediatel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biology, and relates to early stage detection molecular marker of early stage Angiostrongylus cantonensis disease, and primer and correlated kit thereof. The necessary composition of the diagnostic reagent contains: aca-miR-146a-5p sequence and three related primers (stem loop primer, upstream and downstream primer) designed according to the sequence design. The invention firstly provides an application of aca-miR-146a-5p in preparation for diagnosis of Angiostrongylus cantonensis disease. The diagnostic reagent can accurately and simply detect infection of Angiostrongylus cantonensis at early stage, and can distinguish between meningitis or encephalitis caused by Angiostrongylus cantonensis and other meningitis or encephalitis with good social and economic benefits.

Description

technical field [0001] This patent belongs to the field of biology, and relates to a molecular marker that can be used as an early detection of angiostrongylus cantonensis, as well as the primers used and related kits. Background technique [0002] Angiostrongylus cantonensis is also known as eosinophilic meningoencephalitis. It is infected by eating raw or undercooked freshwater snail meat containing Angiostrongylus cantonensis larvae, which parasitize the central nervous system and cause disease. The main clinical manifestations are meningitis, meningitis, encephalitis or myelitis, and the number of eosinophils in peripheral blood and cerebrospinal fluid increases. Severe cases may have persistent high intracranial pressure; there are corresponding manifestations caused by localized damage to the brain; A small number of patients can be fatal or have sequelae. Angiostrongylus cantonensis has been recognized by the world as a new or re-epidemic zoonotic parasitic disease,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/12C12N15/11
CPCC12Q1/6888C12Q2600/178
Inventor 陈小光孙希吴忠道
Owner SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More