Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer
A molecular marker, Angiostrongylia nematode technology, applied in the field of biology, can solve problems such as non-identity, and achieve the effects of reducing clinical symptoms, improving social and economic benefits, and early treatment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Primer design
[0030] The sequence of Angiostrongylus cantonensis-derived miR-146a-5p (aca-miR-146a-5p) was retrieved from the microRNA database mirbase as SEQ ID NO: 1 (UGAGAACUGAAUUCCAUAGGC).
[0031] Design of reverse transcription primer with stem-loop SEQ ID NO: 2: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCCTATGG
[0032] The upstream and downstream primers for real-time PCR are:
[0033] Upstream primer SEQ ID NO: 3: ACACTCCAGCTGGGTGAGAACTGAATTCC
[0034] Downstream primer SEQ ID NO: 4: TGGTGTCGTGGAGTCG
Embodiment 2
[0036] Extraction of total RNA from serum or cerebrospinal fluid
[0037] Take 200 microliters of serum or cerebrospinal fluid into an RNase-free EP tube, centrifuge at 12,000 rpm at 4°C for 10 minutes, transfer the supernatant to another RNase-free EP tube, add 1 ml of trizol, shake vigorously for five minutes, and add Chlorane 200 Microliter, mix well and let stand at room temperature for ten minutes, centrifuge at 12000rpm at 4°C for 15 minutes, transfer the supernatant to another RNase EP tube, add an equal volume of isopropanol, mix and let stand at room temperature for 15 minutes, Then put it at 4°C for 35 minutes, centrifuge at 12000rpm at 4°C for 10 minutes, pour off the supernatant, wash the precipitate with 75% ethanol, centrifuge at 7200rpm at 4°C for 10 minutes, discard and air dry for 10 minutes before adding 20 μl of depc-treated water was used to dissolve the precipitate.
Embodiment 3
[0039]Brain lesions caused by Angiostrongylus cantonensis need to be differentiated from viral meningoencephalitis, tuberculous meningoencephalitis and other brain parasitic diseases: 30 patients with confirmed Angiostrongylus cantonensis infection and 30 cases in the control group (viral meningoencephalitis) Meningoencephalitis, tuberculous meningoencephalitis and other brain parasitic disease patients (10 cases each) lumbar puncture to obtain about one milliliter of cerebrospinal fluid, extract RNA according to the method provided in Example 2, reverse transcribe into cDNA, and then perform real-time quantitative fluorescent PCR , the reaction conditions of real-time fluorescent quantitative PCR are: pre-denaturation 95°C, time 10min; denaturation 95°C, time 15sec, annealing temperature 60°C, time 30sec, extension temperature 72°C, time 15sec, cycle number 40 ;Each sample is tested in multiple wells, and each detection reaction needs to be analyzed by melting curve immediatel...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap