Cloning-free linear expression vector constituting method
The technology of a linear expression vector and a construction method is applied in the field of constructing a linear expression vector without cloning, and can solve the problems of high price and restriction of DNA topoisomerase I, and achieve the effect of low price and lower use cost.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Construction of a linear expression vector containing CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) C:
[0043] Using the plasmid pCMV / myc / cyto / GFP as the template, the CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) were amplified separately C. After digestion and ligation, the linear expression vector D containing the above fragments is obtained. The construction process is as follows figure 1 Shown. (1) Design primers
[0044] Design a pair of primers 1 and 2: at the junction of fragments A and B: primer 1 is the reverse primer of the promoter CMV fragment, and primer 2 is the forward primer of the target gene fragment GFP. Primer 1 and primer 2 contain a DNA sequence complementary to the fragment to be ligated, and a DNA fragment containing the enzyme N.Bpu10I recognit...
Embodiment 2
[0057] Without ligase, construct a linear expression vector containing CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) C:
[0058] Using the plasmid pCMV / myc / cyto / GFP as the template, the CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) were amplified separately C. After digestion and ligation, the linear expression vector D'containing the above fragments is obtained. The construction process is as follows figure 2 Shown.
[0059] (1) Design primers
[0060] The construction principles of primers 1, 2, 1', 2', and 3, 4 are the same as in Example 1. The primer sequences are shown in the table below.
[0061] Primer
Sequence
CMV forward primer (3)
5’gaccgaattcacattgattattg3’
CMV reverse primer (1)
5’ctcGCTCAGG gccagtaagcagtgggttct3’
GFP forw...
Embodiment 3
[0066] Construction of a linear expression vector containing CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) C:
[0067] Using the plasmid pCMV / myc / cyto / GFP as the template, the CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) were amplified separately C. After digestion and ligation, a linear expression vector D containing the above fragment is obtained.
[0068] (1) Design primers
[0069] Primer
Sequence
CMV forward primer (3)
5’gtaccgaattcacattgattattg3’
CMV reverse primer (1)
5’cagttgctgactaaggcaGCTCAGG gccagtaagcagtgggttct3’
GFP forward primer (2)
5’gtccgactgcgagcgggtGCTCAGG atggctagcaaaggagaagaact3’
GFP reverse primer (1′)
5’ttcagacgcctggttccaGCTCAGG ctatttgtagagctcatccatgc3’
BGH forward primer (2′) ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com