Cloning-free linear expression vector constituting method

The technology of a linear expression vector and a construction method is applied in the field of constructing a linear expression vector without cloning, and can solve the problems of high price and restriction of DNA topoisomerase I, and achieve the effect of low price and lower use cost.

Inactive Publication Date: 2003-03-19
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the high price of DNA topoisomerase I, the application of kits for constructing linear expression vectors by this method is limited to a certain extent.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning-free linear expression vector constituting method
  • Cloning-free linear expression vector constituting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Construction of a linear expression vector containing CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) C:

[0043] Using the plasmid pCMV / myc / cyto / GFP as the template, the CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) were amplified separately C. After digestion and ligation, the linear expression vector D containing the above fragments is obtained. The construction process is as follows figure 1 Shown. (1) Design primers

[0044] Design a pair of primers 1 and 2: at the junction of fragments A and B: primer 1 is the reverse primer of the promoter CMV fragment, and primer 2 is the forward primer of the target gene fragment GFP. Primer 1 and primer 2 contain a DNA sequence complementary to the fragment to be ligated, and a DNA fragment containing the enzyme N.Bpu10I recognit...

Embodiment 2

[0057] Without ligase, construct a linear expression vector containing CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) C:

[0058] Using the plasmid pCMV / myc / cyto / GFP as the template, the CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) were amplified separately C. After digestion and ligation, the linear expression vector D'containing the above fragments is obtained. The construction process is as follows figure 2 Shown.

[0059] (1) Design primers

[0060] The construction principles of primers 1, 2, 1', 2', and 3, 4 are the same as in Example 1. The primer sequences are shown in the table below.

[0061] Primer

Sequence

CMV forward primer (3)

5’gaccgaattcacattgattattg3’

CMV reverse primer (1)

5’ctcGCTCAGG gccagtaagcagtgggttct3’

GFP forw...

Embodiment 3

[0066] Construction of a linear expression vector containing CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) C:

[0067] Using the plasmid pCMV / myc / cyto / GFP as the template, the CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and BGHpA (polyadenylic acid) fragment (including terminator) were amplified separately C. After digestion and ligation, a linear expression vector D containing the above fragment is obtained.

[0068] (1) Design primers

[0069] Primer

Sequence

CMV forward primer (3)

5’gtaccgaattcacattgattattg3’

CMV reverse primer (1)

5’cagttgctgactaaggcaGCTCAGG gccagtaagcagtgggttct3’

GFP forward primer (2)

5’gtccgactgcgagcgggtGCTCAGG atggctagcaaaggagaagaact3’

GFP reverse primer (1′)

5’ttcagacgcctggttccaGCTCAGG ctatttgtagagctcatccatgc3’

BGH forward primer (2′) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the constitution method of one kind of linear expression vector, and especially relates to the cloning-free constitution method of one kind of linear expression vector. The method includes introducing nickase identifying gene in the primer design, and nickase enzyme incision and nucleic acid exoenzyme degradation after DNA segment proliferation to form connected segment with protruding end and connecting the segments to obtain linear expression vector. The method of the present invention has greatly lowered constitution cost of linear expression vector and the wide application of the constitution method in scientific research and production can provide technological platform for gene expression and protein function research.

Description

Technical field [0001] The invention relates to a method for constructing an expression vector, in particular to a method for constructing a linear expression vector without cloning. technical background [0002] Usually the protein expression method is to connect the target gene to be cloned with the vector, transform the recombinant into the recipient bacteria, screen and identify the correct clone for amplification, and then transfer it into the host cell for expression. This is currently the most used method in protein expression research. However, this method involves many steps and is tedious and time-consuming. At present, there is also a method of constructing a linear expression vector using the cutting and ligation functions of DNA topoisomerase I. The vector contains a promoter, a target gene and a terminator fragment (Invitrogen's TOPO Tools product introduction). The recognition site of DNA topoisomerase I is CCCTT' site. In primer design, the enzyme recognition site...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07H21/04C12N15/10C12N15/63C12N15/66C12P21/02C12Q1/68
Inventor黄大卫辛文
OwnerINST OF ZOOLOGY CHINESE ACAD OF SCI