Method for externally amplifying specific ring type or concatemer nucleic acid

An in vitro amplification, nucleic acid technology, applied in the field of amplifying circular or tandem DNA, can solve the problems of loss of specificity and selectivity, labor, and low efficiency

Inactive Publication Date: 2005-05-18
包振民 +1
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is very tedious, time-consuming, labor-intensive and costly work to construct a whole genome library or a full-length cDNA library and screen the target sequence, and has a high false positive rate
In comparison, RACE and reverse PCR are more labor-saving and cost-effective, but they also have many problems: not only need to overcome difficulties and take time to design, synthesize and detect suitable RACE primers and reverse primers, but also need to carry out a series of PCR amplification
In addition, the amplification of large circular or linear DNA with sequence-specific primers is time-consuming and inefficient, so random primers are usually used instead of sequence-specific primers for multibranch amplification (hRCA), which makes the RCA reaction more sensitive, but also loss of specificity and selectivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for externally amplifying specific ring type or concatemer nucleic acid
  • Method for externally amplifying specific ring type or concatemer nucleic acid

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0066] In order to prove the feasibility of using the LCA method to amplify and produce circular and linear tandem DNA, use the closed circular natural plasmid pUC19 without an insert or with a 300bp to 2kb insert as a template, and use the method described in the present invention to amplify .

[0067] concatenated amplification of closed circular plasmid DNA

[0068] Mix 10 ng of natural closed circular plasmid pUC19 (no insert or 300bp-2kb insert) and 1.0μM M13 forward and reverse primers, add to 50μl reaction system, which contains 0.5xLA-Taq DNA polymerase buffer (TaKaRa), 0.5x Taq DNA Ligase Buffer (20mM Tris-HCl, 25mM Potassium Acetate, 10mM Magnesium Acetate, 1mM NAD + , 10 mM dithiothreitol, 0.1% Triton X-100) and 400 μM of the four mononucleotides. After pre-denaturation at 95°C for 5 minutes, 5 units of LA thermostable DNA polymerase (TaKaRa) and 40 units of thermostable DNA ligase (New England Biolabs) were added to the reaction mixture. Subsequently, 30 cycles ...

specific Embodiment approach 2

[0085] In this embodiment, the plasmid pCMV2-EGFP was amplified by the same method as Embodiment 1, and the 5' phosphorylation primers used were CMV-F and BGH-R. The amplified circular or tandem DNA was digested with EcoRI and then circularized with T4 DNA ligase, transformed into Escherichia coli JM109, and the bacteria expressed green fluorescent protein, which can be directly observed under ultraviolet light.

[0086] The primer sequences used are as follows:

[0087] CMV-F: CGCAAATGGGCGGTAGGCGTG

[0088] BGH-R: TAGAAGGCACAGTCGAGG

specific Embodiment approach 3

[0089] In this embodiment, the plasmid pCMV2-EGFP was amplified by the same method as Embodiment 1, and the 5' phosphorylation primers used were CMV-F and GFP-R. GFP-R contains three random nucleotides, which can be used to introduce mutations within the green fluorescent protein gene. The amplified circular or tandem DNA was digested with EcoR I and then circularized with T4 DNA ligase, transformed into Escherichia coli JM109, and the bacterium expressed the mutated green fluorescent protein, which could be directly observed under ultraviolet light.

[0090] The primer sequences used are as follows:

[0091] CMV-F: CGCAAATGGGCGGTAGGCGTG

[0092] GFP-R: GCGGACTGNNNGCTCAGGTAG

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The externally amplifying process of specific ring form or concatemer nucleic acid includes the pre-denaturation of ring type or concatemer nucleic acid containing target sequence as the template, one pair of 5'-phosphorylated oligonucleotide primers, four kinds of triphosphodeoxyribonucleotides and thermonucleic acid synthetase in proper buffing system at 90-99 deg.c for 1-30; and subsequent 1-40 thermal circulation treatment. The said thermal circulation includes three steps of: denaturation via maintaining at 90-99 deg.c for 1 sec to 5 min; renaturation and connection at 30-85 deg.c for 10 sec to 15 min; and extension at 65-85 deg.c for 1-30 min. The present invention can produce and amplify ring form or serial DNA externally and optionally.

Description

technical field [0001] The present invention relates to a method for in vitro amplification of circular or tandem nucleic acids, ie DNA. In particular, the invention relates to methods for amplifying circular or tandem DNA in a cell-free system. Background technique [0002] Polymerase chain reaction (PCR) is a powerful and rapid method for exponentially amplifying target nucleic acids, as disclosed in U.S. Pat. Nos. 4,683,195 and 4,683,202. PCR has become the core technology of molecular biology. PCR has greatly developed gene isolation and identification and molecular cloning techniques, including gene sequencing, identification of alleles, and detection of infectious and genetic diseases. PCR is amplified by heat-denaturing the DNA template and primers through thermal cycling, annealing the primers with the complementary DNA strand, and extending the primers with a heat-resistant DNA polymerase. Nucleic acid sequences located between the two primers can be exponentially...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/34
Inventor汪小龙包振民胡景杰张全启吕翠仙
Owner包振民