Check patentability & draft patents in minutes with Patsnap Eureka AI!

Specific antigen of Japanese blood fluke and its use

A schistosomiasis, specific technology, applied in the fields of molecular biology and parasitology, can solve problems such as the specific antigen protein of Schistosoma japonicum that have not been disclosed

Inactive Publication Date: 2005-06-22
SOUTH RES CENT NAT HUMAN GENE GROUP +2
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] However, no specific antigenic protein of Schistosoma japonicum has been disclosed so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific antigen of Japanese blood fluke and its use
  • Specific antigen of Japanese blood fluke and its use
  • Specific antigen of Japanese blood fluke and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Preparation of various serum

[0078] 1.1 Rabbit serum infected with Schistosoma japonicum

[0079] To establish an animal model of Schistosoma japonicum infection. Thirty New Zealand white rabbits were housed in separate cages, and 100 cercariae of Schistosoma japonicum were inoculated through the abdominal wall. Ten weeks after infection, 10 rabbits were randomly selected for drug treatment with 200 mg / kg of praziquantel by gastric feeding. Take 1-2ml of blood from the rabbit ear vein every other week, separate the serum within 12 hours, and freeze it at -20°C.

[0080] 1.2 Saliva and serum of normal people and schistosomiasis patients

[0081] Serum samples from the patients came from the Institute of Parasitic Diseases, Chinese Academy of Preventive Medicine, and the Chinese Schistosomiasis Reference Serum Bank, including 62 serum samples from acute patients and 57 serum samples from chronic patients. Normal human serum and saliva samples were taken from students ...

Embodiment 2

[0083] Acquisition of Sj50 Gene and Sj16 Gene

[0084] 2.1 Design and synthesis of primers

[0085] According to the sequence of Sj50 gene and Sj16 gene, primers were analyzed and designed by Primerexpress software, and two pairs of primers were synthesized by Shanghai Shenyou Bioengineering Company.

[0086] Sj50-F is 5'CCGGAATTCATGTCGGAGACGCCAAAGC3' (SEQ ID NO: 5), and the EcoR I restriction site GAATTC is introduced;

[0087] Sj50-R is 5'CCGCTCGAGCAGAATTAAGCTCTCACAGGGCA3' (SEQ ID NO: 6); the Xho I restriction site CTCGAG is introduced;

[0088] Primer Sj16-F is 5'CCGGAATTCCTTCATCTCAGAATAATGTCGGA3' (SEQ ID NO: 7), which introduces EcoR I restriction site GAATTC;

[0089] Sj16-R is 5'CCGCTCGAGCATACGTTTGACGTACATAAGCT'3' (SEQ ID NO: 8), which introduces the Xho I restriction site CTCGAG.

[0090] The stock concentration of primers is 50mM, and the working concentration is 10mM.

[0091] 2.2. PCR amplification of Sj50 gene and Sj16 gene

[0092] The cDNA of Schistosoma japo...

Embodiment 3

[0119] Expression of Sj16 and Sj50 recombinant genes in Escherichia coli

[0120]The pGEX4T-1-Sj50 and pGEX4T-1-Sj16 recombinant plasmids extracted above were transformed into Escherichia coli BL21 by calcium transfer method. Add 2 μl of the recombinant plasmid to a 1.5ml Eppendorf tube containing 50 μl of BL21 calcium transduction-sensitive peptide cells. After 30 minutes of ice bathing, heat shock at 37°C for 5 minutes, and immediately ice bath for 2 minutes. Add LB culture medium pre-warmed to 37°C to each tube, incubate at 300 rpm at 37°C for 1 hour, take 100 μl and spread it on the LB agar plate containing 100 μg / ml ampicillin, and incubate the culture dish at 37°C overnight.

[0121] Randomly pick Sj16 and Sj50 positive clones and inoculate them in 3 ml of 2XYT liquid medium containing 100 μg / ml benzyl penicillin, shake at 37°C until OD600=0.6. Take 2 ml and add IPTG to a final concentration of 1 mM, and 1 ml without inducer as a control, culture at 28° C. and 250 rpm f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Voltageaaaaaaaaaa
Capacitanceaaaaaaaaaa
Resistanceaaaaaaaaaa
Login to View More

Abstract

The invention provides specific antigens of Schistosoma japonicum, which are Schistosoma japonicum immunisin protein Sj50 and calcium bonded protein Sj16, the genes of Schistosoma japonicum immunisin protein Sj50 and calcium bonded protein Sj16 are isolated, these two proteins are expressed through recombination, thus achieving the source of large quantity diagnosis antigens. Sj50 and Sj16 can responsively and specifically detect Schistosoma japonicum antibody, especially Sj50 has the possibility of distinguishing acute and chronic infection, thus the invention has good application prospect.

Description

technical field [0001] The present invention relates to molecular biology and parasitology. More specifically, the present invention relates to a specific antigen of Schistosoma japonicum, its preparation method and use. Background technique [0002] Schistosoma japonicum is a parasite that seriously threatens human health. [0003] The sensitivity and specificity of immunological diagnostic methods for schistosomiasis are mainly related to the characteristics of the diagnostic antigen used in addition to the difference in the method of selecting the experiment. Although the commonly used crude adult and egg antigens are highly sensitive for diagnosing schistosomiasis, they are prone to cross-reaction because they are often mixed with host antigens and common antigenic components of other parasites such as liver flukes and lung flukes , with low specificity. [0004] In addition, because most of the traditional antigens are insect-derived, the source is small, and the cos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C07K16/18C12N15/12C12N15/63G01N33/68
Inventor 胡薇王兆军沈大康薛纯良冯正韩泽广
Owner SOUTH RES CENT NAT HUMAN GENE GROUP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More