Specific antigen of Japanese blood fluke and its use
A schistosomiasis, specific technology, applied in the fields of molecular biology and parasitology, can solve problems such as the specific antigen protein of Schistosoma japonicum that have not been disclosed
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0077] Preparation of various serum
[0078] 1.1 Rabbit serum infected with Schistosoma japonicum
[0079] To establish an animal model of Schistosoma japonicum infection. Thirty New Zealand white rabbits were housed in separate cages, and 100 cercariae of Schistosoma japonicum were inoculated through the abdominal wall. Ten weeks after infection, 10 rabbits were randomly selected for drug treatment with 200 mg / kg of praziquantel by gastric feeding. Take 1-2ml of blood from the rabbit ear vein every other week, separate the serum within 12 hours, and freeze it at -20°C.
[0080] 1.2 Saliva and serum of normal people and schistosomiasis patients
[0081] Serum samples from the patients came from the Institute of Parasitic Diseases, Chinese Academy of Preventive Medicine, and the Chinese Schistosomiasis Reference Serum Bank, including 62 serum samples from acute patients and 57 serum samples from chronic patients. Normal human serum and saliva samples were taken from students ...
Embodiment 2
[0083] Acquisition of Sj50 Gene and Sj16 Gene
[0084] 2.1 Design and synthesis of primers
[0085] According to the sequence of Sj50 gene and Sj16 gene, primers were analyzed and designed by Primerexpress software, and two pairs of primers were synthesized by Shanghai Shenyou Bioengineering Company.
[0086] Sj50-F is 5'CCGGAATTCATGTCGGAGACGCCAAAGC3' (SEQ ID NO: 5), and the EcoR I restriction site GAATTC is introduced;
[0087] Sj50-R is 5'CCGCTCGAGCAGAATTAAGCTCTCACAGGGCA3' (SEQ ID NO: 6); the Xho I restriction site CTCGAG is introduced;
[0088] Primer Sj16-F is 5'CCGGAATTCCTTCATCTCAGAATAATGTCGGA3' (SEQ ID NO: 7), which introduces EcoR I restriction site GAATTC;
[0089] Sj16-R is 5'CCGCTCGAGCATACGTTTGACGTACATAAGCT'3' (SEQ ID NO: 8), which introduces the Xho I restriction site CTCGAG.
[0090] The stock concentration of primers is 50mM, and the working concentration is 10mM.
[0091] 2.2. PCR amplification of Sj50 gene and Sj16 gene
[0092] The cDNA of Schistosoma japo...
Embodiment 3
[0119] Expression of Sj16 and Sj50 recombinant genes in Escherichia coli
[0120]The pGEX4T-1-Sj50 and pGEX4T-1-Sj16 recombinant plasmids extracted above were transformed into Escherichia coli BL21 by calcium transfer method. Add 2 μl of the recombinant plasmid to a 1.5ml Eppendorf tube containing 50 μl of BL21 calcium transduction-sensitive peptide cells. After 30 minutes of ice bathing, heat shock at 37°C for 5 minutes, and immediately ice bath for 2 minutes. Add LB culture medium pre-warmed to 37°C to each tube, incubate at 300 rpm at 37°C for 1 hour, take 100 μl and spread it on the LB agar plate containing 100 μg / ml ampicillin, and incubate the culture dish at 37°C overnight.
[0121] Randomly pick Sj16 and Sj50 positive clones and inoculate them in 3 ml of 2XYT liquid medium containing 100 μg / ml benzyl penicillin, shake at 37°C until OD600=0.6. Take 2 ml and add IPTG to a final concentration of 1 mM, and 1 ml without inducer as a control, culture at 28° C. and 250 rpm f...
PUM
Property | Measurement | Unit |
---|---|---|
Voltage | aaaaa | aaaaa |
Capacitance | aaaaa | aaaaa |
Resistance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com