Histone methyl transferase and its preparing method

A protein and protein polypeptide technology, applied in the field of molecular biology, can solve problems such as unclear functions

Active Publication Date: 2005-10-19
RUIJIN HOSPITAL ATTACHED TO SHANGHAI NO 2 MEDICALUNIV
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

First, they can specifically modify different sites of histones. It is known that the lysines on histone H3 that can be methylated include K4, K9, K27, K36, and K79, among which K27 and K36 are methylated. still not clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Histone methyl transferase and its preparing method
  • Histone methyl transferase and its preparing method
  • Histone methyl transferase and its preparing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0094] Embodiment 1: Cloning of HSPC069SET protein cDNA

[0095] The cDNA fragment of HSPC069SET comes from a CD34-positive hematopoietic stem / progenitor cell cDNA library constructed by conventional methods (see Zhang et al., Genome Res .2000, 10:1546-6). PCR was performed using the cDNA library as a template and a pair of oligonucleotides as primers—upstream: ctcagatctaacagggacctaaggacatcatc (SEQ ID NO: 7) and downstream: cgcggtaccttattttcaatatattcacatatacatta (SEQ ID NO: 8). The amplified fragment was digested with BglII / KpnI, and connected into the pEGFP vector (Clontech Company) to obtain the HPC069SET-pEGFP plasmid, and the nucleotide sequence of the obtained HSPC069SET was identified by sequencing.

[0096] The full length of HSPC069SET cDNA is 6731bp (SEQ ID NO: 1), contains a complete open reading frame (position 72-3704), and encodes a polypeptide containing 1211 amino acid residues (SEQ ID NO: 2). Homology comparison shows that this amino acid sequence contains a...

Embodiment 2

[0102] Expression and purification of HSPC069SET protein in Escherichia coli

[0103] Using the extracted hematopoietic stem cell mRNA as a template, after reverse transcription, use a pair of oligonucleotides as primers-A: gcgtcgacgtgatggtgagcttcaggacaga (SEQ ID NO: 9) and B: aactgcagatgtgaggcagacaagtcattcca (SEQ ID NO: 10) to perform PCR . The amplified fragment was digested with restriction endonuclease SalI / PstI, and the product was ligated into pGBKT7 (purchased from Clontech Company) to obtain the HPC069SET-pGBKT7 plasmid, and the obtained cDNA was identified by sequencing.

[0104] Then, HPC069SET-pGBKT7 was digested with restriction endonuclease EcoRI, and then ligated into pGEX-5X1 vector (Amersham Biosciences) to obtain HSPC069SET-pGEX-5X1 plasmid. Sequencing confirmed that the cDNA fragment of HSPC069SET was correctly inserted into the vector. Escherichia coli BL21 strain was transformed with this plasmid. Positive transformants were cultured overnight in LB medi...

Embodiment 3

[0107] Construction of mutants and acquisition of mutant proteins

[0108] Using the conventional bridge PCR method, on the basis of the HSPC069SET-pGEX-5X1 plasmid prepared in Example 2, the 1122th arginine in the SET domain of the HSPC069SET protein was mutated to histidine (i.e. SEQ ID NO: 449th out of 4). By the same method as in Example 2, the mutated HSPC069SETMp protein was obtained with the mutant plasmid,

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention provides one new histone methyl transferase, HSPC069SET protein, polynucleotides coding the HSPC069SET protein, and recombinant technological process of generating the HSPC069SET protein. The present invention also discloses the use of polynucleotides coding this HSPC069SET protein. The HSPC069SET protein has histone methyl transferring function.

Description

technical field [0001] The invention belongs to the field of molecular biology, in particular, the invention relates to a new polynucleotide encoding human histone methyltransferase HSPC069SET, and a polypeptide encoded by the polynucleotide. The present invention also relates to the use and preparation of such polynucleotides and polypeptides. Background technique [0002] The post-translational modification of histones plays an important role in the regulation of chromosome structure and gene transcription activity. These modifications mainly include acetylation, phosphorylation, methylation, ADP ribosylation and ubiquitination. [0003] In the past two years, great breakthroughs have been made in the functional research of histone methylation, especially the research on the methylation of histone H3. For example, methylation of lysine 9 in histone H3 is associated with gene inactivation ( Science .2001, 293:1150-5); and the methylation of lysine 4 in histone H3 is asso...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C07K16/40C12N9/10C12N15/54C12N15/63C12N15/85G01N33/53
Inventor陈竺孙晓建黄秋花吴昕彦胡鸣陈赛娟
OwnerRUIJIN HOSPITAL ATTACHED TO SHANGHAI NO 2 MEDICALUNIV