Chimeric type 5/type 11 or type 35 adenovirus vector for preventing infection with antihuman immunodeficiency virus

An immunodeficiency virus and virus vector technology, which is applied to chimeric type 5/11 or type 35 adenovirus vectors and their medical application fields, can solve problems such as hepatotoxicity, and achieve improved affinity, reduced toxicity, Effectiveness in the treatment and prevention of HIV infection

Inactive Publication Date: 2006-12-27
ZHEJIANG HISUN PHARMA CO LTD
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Ad5 is prone to hepatotoxicity due to

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric type 5/type 11 or type 35 adenovirus vector for preventing infection with antihuman immunodeficiency virus
  • Chimeric type 5/type 11 or type 35 adenovirus vector for preventing infection with antihuman immunodeficiency virus
  • Chimeric type 5/type 11 or type 35 adenovirus vector for preventing infection with antihuman immunodeficiency virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] (1) Construction of chimeric type 5 / type 35 adenovirus vector of the present invention

[0079] Construct the chimeric type 5 / type 35 adenoviral vector of the present invention by using the kit of Avior Therapeutics, Inc (Seattle, WA) as described below, wherein the rev gene and env gene of HIVIIIB of HIVB subtype are expressible The mode is integrated into a replication-deficient type 5 adenovirus with deletion of E1 and E3, the fiber protein coding gene of the type 5 adenovirus is replaced by the fiber protein coding gene of the type 35 adenovirus.

[0080] The construction kit purchased from Avior Therapeutics, Inc (Seattle, WA) includes a left-handed shuttle plasmid (pLHSP) comprising Ad5 22-342 and 3523-5790, E. coli replication origin and amoxicillin resistance gene and A right-handed chimeric shuttle plasmid (pRHSP5 / 35) of a replication-defective adenovirus type 5 comprising deletions of E1 and E3, wherein the fibrin-encoding gene of the adenovirus type 5 is enco...

Embodiment 2

[0094] Evaluation of Recombinant Viruses

[0095] (1) method

[0096] 1) Experimental animals and immunity

[0097] Eight-week-old female BALB / c mice were purchased from Japan's SLC Inc., Japan's Shizuoka, and kept at the Animal Convenience Center on a 12-hour day and night basis. Immunization method reference figure 2 . At 0, 1, and 2 weeks, mice were injected intramuscularly with 100 μg of pCAG dissolved in phosphate buffered saline (PBS) rev / env or pCAG empty plasmid (rev / env removed plasmid) DNA to immunize mice and inject 10 10 Ad5 / F35-LacZ of vp or, intramuscularly or intradermally injected 10 10 vp Ad5 / F35-HIV for booster immunization. For the group immunized with viral vector alone, 10 in PBS 10 Ad5 / F35-LacZ or Ad5 / F35-HIV of vp was administered by intramuscular, intraperitoneal, subcutaneous or intradermal injection.

[0098] 2) Tetramer experiment

[0099] Tetramer assays were performed 1 week after the final immunization. PE-conjugated H-2Dd / p18 tetramer ...

Embodiment 3

[0118] (1) Construction of chimeric type 5 / type 35 adenovirus vector comprising HIV C subtype Env gene / Gag gene

[0119] The chimeric type 5 / type 35 adenovirus vector of the present invention is constructed by the following homologous recombination method, wherein the env gene (gp120, 2kbp) and gag gene (1.5kbp) of HIV C subtype (96ZM651.8 strain) ) expressably integrated into a replication-defective type 5 adenovirus deleted for E1 and E3, the fiber protein-encoding gene of type 5 adenovirus being replaced by the fiber protein-encoding gene of type 35 adenovirus.

[0120] The complete HIV subtype C gp120 coding gene (2kbp, C / gp120) and gag coding gene (1.5kbp, C / gag) (GeneBank No.AF286224) were amplified in recombinant vaccinia virus vT331 strain (Gao F. et al ., J. Virol., 1998, Vol.72, 5680-5690). DNA fragments of C / gp120 and C / gag were synthesized by PCR using the following primers:

[0121] C / gp120-5' Primer: aagaattcctcgagaaaatgagagtgagggagatact

[0122] C / gp120-3' Pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A chimeric type 5/type 11 or type 35 adenovirus vector, wherein a gene encoding the envelope protein of human immunodeficiency virus or its mutant having an equivalent function is integrated into a nonproliferation type 5 adenovirus in such a manner as allowing the expression and a gene encoding the fiber protein of the type 5 adenovirus is substituted by a gene encoding the fiber protein of a type 11 or type 35 adenovirus or a mutant having an equivalent function, has a lessened toxicity on the liver and can induce an extremely potent HIV-specific immune response. Thus, it is highly efficacious as a drug for preventing HIV-infection.

Description

technical field [0001] The present invention relates to a chimeric type 5 / type 11 or type 35 adenovirus vector for protecting against human immunodeficiency virus infection. Specifically, the present invention relates to a chimeric type 5 / type 11 or type 35 adenovirus vector and its medical application, the vector includes: replication defective type 5 adenovirus; A gene encoding an envelope protein of human immunodeficiency virus (HIV) within an adenovirus type 5, wherein the fibrin-encoding gene of an adenovirus type 5 is encoded in an expressible manner by a fibrin protein of an adenovirus type 11 or type 35 replaced by the gene. Background technique [0002] Highly active anti-retroviral therapy (Highly active anti-retroviraltherapy, HAART) has achieved good results in reducing the mortality of HIV-infected patients. However, there are problems of high incidence of side effects and drug resistance in HAART, and it is difficult to obtain therapeutic drugs for this disea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/63C12N7/01A61K35/76A61K48/00A61P31/18A61P37/04A61K35/761A61K38/16A61K39/21C12N7/00C12N15/09C12N15/86C12N15/861
CPCC12N15/86C12N2710/10344A61K2039/5256C12N2740/16234A61K38/162C12N2840/203C12N2710/10343C12N2710/10322C12N2770/36143A61P31/18A61P37/04
Inventor 岛田胜奥田研尔
Owner ZHEJIANG HISUN PHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap