L-glutamate oxidase
a technology of l-glutamate and oxidase, which is applied in the field of new l-glutamate oxidase, can solve the problems of glutamate oxidase, the amino acid sequence of the enzyme, and the production process of l-glutamate oxidase not necessarily simpl
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Analysis of a Gene Encoding L-Glutamate Oxidase
(1) Probe
[0056] L-glutamate oxidase derived from Streptomyces sp. X-119-6 (ATCC 39343) is constituted by three subunits. In the present invention, the following probes (probe α and probe γ) were used. The probes were designed on the basis of the N-terminal amino acid sequences of α and γ subunits, which had been previously analyzed (α subunit: Ala-Asn-Glu-Met-Thr-Tyr-Glu . . . , γ subunit: Ala-Ile-Val-Thr-Ile-Pro-Phe . . . ).
[0057] Probe α: 5′-AACGAGATGAC(C or G)TACGAGCA-3′
(20 mers, 2 probes, (G+C) content=50%, Tm=60° C.)
[0058] Probe γ: 5′-GC(C or G)ATCGT(C or G)AC(C or G)ATCCC(C or G)TT-3′
(20 mers, 16 probes, (G+C) content=50%, Tm=64° C.)
(2) Cloning
[0059] A chromosomal DNA derived from Streptomyces sp. X-119-6 (ATCC 39343) was prepared through a conventional method, and the DNA was cleaved with BamHI. Subsequently, the resultant DNA fragments were subjected to agarose gel electrophoresis, to thereby obtain DNA fragments havin...
example 2
Production of L-Glutamate Oxidase by Use of E. coli (1)
[0071] The L-glutamate oxidase gene ORF was amplified through PCR by use of the following two primers (A) and (B) (purchased from Pharmacia) and, as a DNA sample, plasmid pGS1 containing a full-length L-glutamate oxidase gene.
Primer (A):5′-CCACACCGGGGCCGAATTCATGAACCGAGAT-3′Primer (B):5′-AGGTACTCGGCCACCCTGCAGGTC-3′
[0072] Amplification of the L-glutamate oxidase gene through PCR was performed by use of a GeneAmp PCR System 2400 (product of Perkin-Elmer Cetus Instrument) through 25 cycles of treatment, each cycle consisting of thermal denaturation (96° C., 10 seconds), annealing (55° C., 30 seconds), and polymerization (60° C., 120 seconds) of 50 μL reaction mixture which contained 10×PCR buffer (5 μL), 25 mM MgCl2 (5 μL), dNTP (8 μl), primer DNAs (A) and (B) (10 pmol each), the DNA sample (about 0.5 μg), and LA Tag DNA Polymerase (product of Takara Shuzo Co., Ltd.).
[0073] After amplification of the gene, a 3M sodium acetate so...
example 3
Production of L-Glutamate Oxidase by Use of E. coli (2)
[0086] The L-glutamate oxidase gene was amplified by use of an LA-PCR kit (product of Takara Shuzo Co., Ltd.), the following two primers (C) and (D), which were produced on the basis of the ORF nucleotide sequence obtained through the above analysis, and chromosomal DNA derived from Streptomyces sp. X-119-6 (ATCC 39343) serving as a template.
Primer (C):5′-GCGCCATGGAGGAATTCGCGCATGAACGAGATGACCTACGAGGAGCTGGCCGGC3′Primer (D):5′-GCGAAGCTTGATCATGACGTCAGTGCTTCCTCTCGCATC3′
[0087] Amplification of the L-glutamate oxidase gene by use of the LA-PCR kit was performed by means of a PCR Thermal Cycler (product of Takara Shuzo Co., Ltd.) through cycles of treatment, each cycle consisting of thermal denaturation (94° C.), annealing (68° C.), and elongation (68° C.) of GC buffer I•II solution (included in the LA-PCR Kit) containing dNTP, LA Tag, a template DNA (genomic DNA treated with SacI), and the primers (C) and (D).
[0088] After amplifica...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
pH | aaaaa | aaaaa |
pH | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com