Method for producing hydroxycarboxylic acid by enhancing synthesis of coenzyme

a technology of hydroxycarboxylic acid and coenzyme, which is applied in the field of microorganisms, can solve the problems of increasing production cost, high cost of purified products, and inability to use raw materials for packing at low cost, and achieves the effect of efficient production

Inactive Publication Date: 2009-09-03
MITSUI CHEM INC
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0020]It is an object of the present invention to provide a method for producing hydroxycarboxylic acids by a microorganism, by which hydroxycarboxylic acids can be efficiently produced using a small amount of microbial cell, and a microorganism suitable for the production method.
[0021]From the results of studies to solve the above objects, the present inventors have found that hydroxycarboxylic acids can be efficiently produced by using a microorganism in which an ability to produce nicotinamide adenine dinucleotide is enhanced, in a method for producing a hydroxycarboxylic acid from aliphatic polyhydric alcohol having a hydroxyl group at the end by using a microorganism.
[0049]According to the present invention, hydroxycarboxylic acids can be efficiently produced using a small amount of microbial cell. Further, according to the present invention, a microorganism suitable for producing hydroxycarboxylic acids can be provided. change in an amount of accumulated glycolic acid in Example 10:
[0056]The present invention relates to a method for producing a hydroxycarboxylic acid. This method is a method for producing a hydroxycarboxylic acid from an aliphatic polyhydric alcohol having a hydroxyl group at the end by using a microorganism, which comprises using the microorganism in which an ability to produce nicotinamide adenine dinucleotide is enhanced.

Problems solved by technology

Glycolic acid of a chemically synthesized product which is currently commercially available contains quite a few impurities, which is a problem when used as a raw material for polymers in view of purity.
Of course, it is technically possible to remove impurities by purification, but such the purified products are actually high in cost and thus are not practical as a raw material for packing at low cost.
In a reaction for producing hydroxycarboxylic acids including glycolic acid by the above-mentioned conventional methods, an amount of microbial cell required for the reaction is large, which thereby causes problems such as an increase in the production cost, contamination by impurities derived from the microbial cells, and requiring so much work and cost for disposing the microbial cells after the production of hydroxycarboxylic acids.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing hydroxycarboxylic acid by enhancing synthesis of coenzyme
  • Method for producing hydroxycarboxylic acid by enhancing synthesis of coenzyme

Examples

Experimental program
Comparison scheme
Effect test

production example 1

[0114]Construction of Escherichia coli MG1655nadR-Deleted Strain

[0115]The entire base sequence of the genome DNA of Escherichia coli MG1655 strain has been already reported in GenBank accession number U00096, and the nadR gene is encoded at the bases of from Base No. 4625317 to Base No. 4626570 in the base sequence. Oligonucleotides represented by Sequence No. 1 (AGGAAGTGCCATTCTGATTGG) and Sequence No. 2 (GGAATTCGTATATCTCATTATAAGTCGTCG), and Sequence No. 3 (GGAATTCGTGATGAAACTGCTCAAAGG) and Sequence No. 4 (TTGGTACCTGATGACCTGAGCTTCTCG), constructed on the basis of the gene information of the domain near the nadR gene of the genome DNA of the Escherichia coli MG1655 strain, were used for a PCR amplification using the genome DNA of Escherichia coli MG1655 strain as a template. The obtained DNA fragment was digested with restriction enzymes NdeI and EcoRI, and EcoRI and KpnI, respectively, to obtain fragments of about 850 bp and 970 bp, respectively.

[0116]These DNA fragments were mixed w...

production example 2

[0120]Construction of Escherichia coli MG1655glcDEF-Deleted Strain

[0121]The entire base sequence of the genome DNA of Escherichia coli has been already reported (GenBanak accession number U00096), and the base sequence of a gene (may be referred to as glcDEF herein below) of glycolate oxidase of Escherichia coli has been also already reported (GenBank accession number L43490).

[0122]Oligonucleotides of Sequence No. 5 (TTGGTACCGTTCTGCCAGCAACTGACG) and Sequence No. 6 (TGTCTAGAGTACCTCTGTGCGTCACTGG), and Sequence No. 7(GCTCTAGACGCTTTGTTGTGTTGTGTGG) and Sequence No. 8(AACTGCAGGATCGGTCAATGATTGCAGC), constructed on the basis of the gene information of the domain near glcDEF of the genome DNA of the Escherichia coli MG1655 strain, were used for a PCR amplification. Each of the obtained DNA fragments was digested with restriction enzymes KpnI and XbaI, and XbaI and PstI, respectively, to obtain fragments of about 670 bp and 790 bp, respectively.

[0123]These DNA fragments were mixed with the fr...

production example 3

[0128]Construction of Escherichia coli MG1655nadR&glcDEF-Deleted Strain

[0129]For the AnadR strain obtained in Production Example 1, glcDEF was deleted in the same manner as in Production Example 2. The obtained strain was named as MG1655nadR&glcDEF-deleted strain (hereinafter, may be abbreviated as ΔnadRΔglcDEF strain).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

Hydroxycarboxylic acids are produced by using a microorganism that is improved in ability to produce nicotinamide adenine dinucleotide by deleting, mutating or substituting nadR gene in the microorganism or introducing a gene encoding nicotinic acid phosphoribosyltransferase.

Description

TECHNICAL FIELD[0001]The present invention relates to a microorganism which produces hydroxycarboxylic acids including glycolic acid and a method for producing hydroxycarboxylic acids including glycolic acid by using the microorganism.BACKGROUND ART[0002]Since hydroxycarboxylic acids are useful as a raw material for polymers or an intermediate for medicines, a method for effectively producing hydroxycarboxylic acids have been demanded.[0003]As an example, glycolic acid (α-hydroxyacetic acid) can be mentioned. Glycolic acid has been used as a raw material for cleaning agents or cosmetics, but has recently received attention as a raw material for polyglycolic acid which is useful as a gas barrier polymer or a medical polymer. The reason why glycolic acid has received attention as a gas barrier material is that a layer of polyglycolic acid has high oxygen barrier property and performance as a material for packing food or carbonated beverage which can easily spoil in the presence of oxy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12P7/42C12N9/04
CPCC12N9/1077C12Y204/02011C12P7/42C12N1/20C12N15/09
InventorMORISHIGE, TAKASHIWADA, MITSUFUMITAKAHASHI, HITOSHIMOCHIZUKI, DAISUKETOKUDA, JUNKO
OwnerMITSUI CHEM INC