Compositions for inducing immune responses specific to globo h and ssea3 and uses thereof in cancer treatment
a technology of immune response and globo h, which is applied in the field of compositions for inducing immune responses specific to globo h and ssea3 and their use in cancer treatment, can solve the problems of unsatisfactory anti-cancer efficacy, and achieve the effect of promoting the production of anti-globo h
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Induction of Antibodies Specific to Globo H and SSEA3 with KLH-Conjugated Globo H and α-GalCer
[0034]Globo H-KLH was purchased from Optimer Pharmaceuticals. Three groups of 6-week-old female BALB / b mice (BioLASCO), two in each group, were injected (s.c.) with PBS (“control mice”), 0.6 μg KLH-Globo H (“Globo H mice”), and 0.6 μg KLH-Globo H in combination with 2 μg α-GalCer (“Globo H-GalCer mice”), respectively, once every week for three weeks. Sera were collected from the mice of each group 10 days after the last injection and antibodies specific to Globo H and SSEA3 were detected following the method described in Huang et al., Proc, Natl. Acad. Sci. USA 103:15-20 (2006). Briefly, the sera were diluted 1:25 with 3% BSA / PBS buffer and 50 ml of each diluted serum were incubated with a slide, to which Globo H and SSEA3 were attached, in a humidifying chamber for 1 hour. The slide was washed three times with 0.05% PBS / Tween 20 (PBST) and subsequently incubated with 100 μl Cy5-conjugated ...
example 2
Inhibition of FUT1 and FUT2 Via RNA Interference Reduced Levels of Globo H
[0036]The levels of FUT1 and FUT2 mRNAs in three breast cancer cell lines, MCF-7, MB157, and T-47D, were determined by quantitative RT-PCR as follows. Total RNAs were extracted from these cancer cells and cDNAs were produced via reverse transcription using the RNAs as the template and oligo(dT) as the primer. Fifty nanograms of the cDNAs were subjected to RT-PCR using the following primers: L-fut1: CCTGCCAGACTCTGAGTTCC and AGGCTTAGCCAATGTCCAGA as well as L-fut2: GGGAGTTACCGGTGCAGATA and R-fut2: GTCCCAGTGCCTTTGATGTT. The RT-PCR reaction was carried out under the following conditions: 50° C. for 2 min, 95° C. for 10 min, followed by 40 cycles of 95° C. for 10 sec and 60° C. for 1 min, using an ABI Prism 7000 Sequence Detection System and the results thus obtained were analyzed using the ABI Prism 7000 SDS software (Applied Biosystems) to obtain a threshold cycle number (Ct value) for the mRNA levels of FUT1 and ...
example 3
Anti-Cancer Effects of SiFUT1 and SiFUT2 Inhibiting Cancer Cell Growth
[0041]Breast cancer cells MB157 and T-47D were seeded at 1×104 cells per well in a 96-well plate (Corning). They were then mixed with or without the virus particles described in Example 2 above that express siFUT1 or siFUT2 and centrifuged at 300 g for 5 min for spin infection. 24 hours later, alamar blue (AbD Serotec) was added to the cells at a final concentration of 1:10 dilution and the cells were then cultured at 37° C., 5% CO2 for 3 hr. Subsequently, the absorbance at 544 nm and 590 nm was measured with a SpectraMax M2 Reader. The cells were cultured under the same conditions with fresh medium and the absorbance at 544 nm and 590 nm was again measured at 48, 72, and 96 hr after the initial seeding process. Results obtained from this study show that both the MB157 and T-47D cells infected with the virus particles decreased their growth rate as compared with the non-infected cells. These data demonstrate that ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Composition | aaaaa | aaaaa |
| Immunogenicity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More