Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions
a technology of vegfr and vegfr derivatives, which is applied in the direction of drug compositions, instruments, and metabolic disorders, can solve the problems of hypertension association of mother and mother proteinuria, impaired placental blood flow, and increased mortality of maternal, fetal and neonatal mortality worldwid
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Sequence of the Novel sFlt-14
[0254]Materials and Experimental Procedures
[0255]RNA
[0256]Placental tissue was homogenized with a Polytron homogenizer and preceded the total RNA extraction in TRI Reagent (Sigma) according to the manufacturer's protocol. Cells were harvested and RNA was extracted in TRI Reagent.
[0257]RACE
[0258]Rapid Amplification of cDNA Ends was preformed using BD SMART™ RACE cDNA amplification kit. 3′ RACE based on preeclamptic placental RNA was used with a primer taken from the beginning of FLT1's exon 14 used as the 5′ primer CCTCCTGCGAAACCTCAGTG (SEQ ID NO: 12) and a 3′ primer that was supplied with the RACE kit: AAGCAGTGGTATCAACGCAGAGTAC(T)30 VN (SEQ ID NO: 11).
[0259]Results
[0260]As is illustrated in FIGS. 1-3, the novel sFlt1 of the present invention differs from the full transmembrane receptor Flt1 and from the known sFlt1 in the following three aspects:
1) sFlt-14 does not comprise the 31 amino acids unique to sFlt-1 (derived from intron 13) as clear from FIG. 1...
example 2
Generation of sFlt-14 Specific Antibodies
[0262]Materials and Experimental Procedures
[0263]Generation of sFlt-14 Specific Polyclonal Antibodies
[0264]Polyclonal antibodies were generated as described in the Sigma-Aldrich's protocol. In short, two peptides derived from sFlt-14 were synthesized (CHFK, SEQ ID NO: 6 and CESS, SEQ ID NO: 5) and injected into rabbits in order to produce anti sFlt-14 sera. Three injections for each peptide were performed, with a month period kept between injections. At the end of this procedure rabbit serums were evaluated for sFlt-14 reactivity.
[0265]Results
[0266]Two short peptides were generated from the amino acid sequence which distinguishes the novel sFlt-14 of the present invention from the previously described sFlt-1. As illustrated in FIG. 3B, the first peptide, termed CHFK (SEQ ID NO: 6), which was derived from exon 14, is not comprised in sFlt-1 but is present in the full transmembrane receptor. The second peptide, termed CESS (SEQ ID NO: 5), was d...
example 3
Relative Abundance of Transmembrane Flt-1, sFlt-1 and sFlt-14 in Different Cells
[0268]Materials and Experimental Procedures
[0269]Cells
[0270]Cells were obtained and cultured as previously described in Gluzman et al. [Gluzman et al., Biochem Biophys Res Commun. (2007) 359:263-8].
[0271]RNA
[0272]Normal placenta tissue and preeclampsia placenta tissue were homogenized with a Polytron homogenizer and preceded the total RNA extraction in TRI Reagent (Sigma) according to the manufacturer's protocol. Cells were harvested and RNA was extracted in TRI Reagent.
[0273]Northern Blotting
[0274]Total RNA (5-20 μg) was resolved by formaldehyde—agarose (1%) denaturing gels and blotted to positively charged nylon membrane by capillary elution. The RNA was UV crosslinked (1200 j / m2) and the membrane was stained with 0.1% methylene blue to ensure equal loading and transfer. Blots were hybridized overnight with a 32P-labeled probe by a rediprime kit (Amersham). The blots were subjected to two washes (with ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| solubility | aaaaa | aaaaa |
| concentrations | aaaaa | aaaaa |
| affinity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More