Natural antibacterial agent-recombinant chicken-beta alexin protein Gal-9 preparation method
A natural antibacterial agent, β-defensin technology, applied in the field of biomaterial preparation, can solve the problems of human health and environmental threats, antibiotic residues, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0021] The utility model is described in more detail below in conjunction with accompanying drawing example:
[0022] 1. Design specific primers according to the published chicken-beta defensin Gal-9 gene sequence, upstream primer: 5'-GGA TCC CCG GAA TTC ATG CAG ATC CTG CCT CTC-3', downstream primer: 5'-TCA GGA ATA CCA TCG GCT CCG GCA GCA GAA-3`
[0023] 2. The chicken β-defensin Gal-9 gene was amplified from the chicken tongue tissue by RT-PCR and cloned into the PMD-T vector, which was determined to be the chicken-β-defensin Gal-9 gene by sequence determination. (The shaded part is the target gene sequence, the rest is the vector, the primers are in the box, and the start codon and stop codon are in italics):
[0024]
[0025]
[0026]
[0027]
[0028]
[0029] AAGCTTGGGA
[0030] ATCTCTAAGGATCCCCGGGTACCGAGCTCGAATTCGTAATCAT
[0031] GGTCATAGCTGTTTCCTGTGTGAAATTGTTATTCCCGCTCACAA
[0032] TTCCACACAACATACC
[0033] 3. Construction of prokaryotic expression...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap