Method of building animal model for parkinsonism

A Parkinson's disease and animal model technology, applied in biomedicine, geriatrics, transgenic technology, and neurology in biomedicine, can solve problems such as limiting the application of models, inability to accurately simulate the pathological process of Parkinson's disease, and achieve the goal of exacerbating death Effect

Inactive Publication Date: 2008-06-25
FUDAN UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

None of the above models can accurately simulate the pathological process of Parkinson's disease. For example, Lewy bodies do not appear in the MPTP model; α-synuclein transgenic animals have great differences in phenotype due to the influence of different promoters, although Model with Lewy body-like deposits but no progressive loss of dopaminergic neurons
The deficiencies of the above-mentioned animal models greatly limit the application of these models

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of building animal model for parkinsonism
  • Method of building animal model for parkinsonism
  • Method of building animal model for parkinsonism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The BAG5 cDNA of embodiment 1 cloning mouse

[0030] Total RNA was extracted from the brain of 8-week-old C57 / BL6 mice, 5ug RNA was reverse-transcribed in a 20ul system, and 1ul was taken as a template. In the 20ul system, primer 1: 5'ACCTGAATTCGTGAAACTGAACACAGAAGTATG 3'(SEQ ID NO: 3) was used and Primer3: 5'CGATCAAGCCCTGCAGCTCTGTC 3' (SEQ ID NO: 4) to amplify the 5' end of BAG5 cDNA by PCR, using primers Primer2: 5'GACAGAGCTGCAGGGCTTGATCG 3' (SEQ ID NO: 5) and Primer 4: 5'ACCTGAATTCTTA CTTGTCATCGTCGTCCTTGTAGTCATACTCCCACTCGTCCGACTTCATG 3' (SEQID NO: 6) was used to amplify the 3' end of BAG5 cDNA by PCR; then take 1 ul of BAG5 cDNA 5' end PCR product and 1 ul of BAG5 cDNA 3' end PCR product, and use primers Primer1 and Primer 4 to amplify the full-length BAG5 cDNA by PCR . Primer 4 contains the Flag tag sequence (the underlined part in the primer) to facilitate the identification of the protein and distinguish it from the endogenous BAG5 protein; Primer 1 and Primer 4 ...

Embodiment 2

[0032] Example 2 Construction of prTH-globin-BAG5-Flag-hGH plasmid

[0033] Establish a dopaminergic neuron-specific transgenic construct prTH-globin-hGH, which contains (a) the promoter of rat tyrosine hydroxylase (6.8 kb in length, available at Guided expression of enhanced green fluorescent protein in the human dopaminergic cell line SH-SY5Y, see Figure 2a ), (b) part of the globin gene (1.0kb), (c) human growth hormone minigene (providing PolyA tail), see Figure 2b ;

[0034] The BAG5-Flag fragment was excised from the plasmid pBluescript BAG5-Flag with the restriction endonuclease EcoR I, cloned into the EcoR I site in the step 3 transgenic vector-globin gene, identified the direction, and established the dopaminergic neuron-specific process The transgenic construct prTH-globin-BAG5-Flag-hGH expressing BAG5-Flag ( Figure 3a ).

Embodiment 3

[0035] Example 3 BAG5-Flag was introduced into mouse fertilized eggs by microinjection and production of transgenic positive mice

[0036] After the transgenic plasmid prTH-globin-BAG5-Flag-hGH was linearized with the restriction endonuclease Not I (14.7kb), gel recovery and purification ( Figure 3b ). The linearized DNA (about 500 copies) was injected into the male pronucleus of mouse fertilized eggs, and the injected fertilized eggs were transplanted into pseudopregnant mice. About 20 days later, the mice were born. Three weeks after the birth of the mice, the tails were clipped to extract DNA, and two sets of PCR reactions were used to test the primers shown in Table 1 to analyze whether there was integration of the transgene. Two sets of primer names: TH-1 (SEQ ID NO:7) and B5-6 (SEQ ID NO:9), Globin1 (SEQ ID NO:8) and B5-6 (SEQ ID NO:9).

[0037] Table 1

[0038] serial number

Sequence (5'-3' or amino-terminal-carboxyl

base end)

SEQ ID NO ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the biomedical field, in particular to a parkinsonism mouse model, a method for establishing the parkinsonism mouse model and application of the parkinsonism mouse model. The invention transfers an extrinsic BAG5-Flag expression cassette to a genome of the animal model, and the expression cassette comprises: (a) a promoter of the rat tyrosine hydroxylase, (b) a part of Beta-globin gene and BAG5-Flag, and (c) a human somatotropin mini gene. The invention also provides the method for establishing the parkinsonism mouse model, and the parkinsonism mouse model obtained by the method of the invention can be used for studying an ubiquitin-protein degradation system and a pathology process mechanism, and screen medicine applied to delay and treatment of parkinsonism.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to the fields of neurology, geriatric medicine and transgene technology in biomedicine. More specifically, it relates to a Parkinson's disease mouse model, a method for establishing the Parkinson's disease mouse model, and uses of the Parkinson's disease mouse model. Background technique [0002] Parkinson's disease (PD) is a brain disease that exhibits motor dysfunction due to a large loss of dopaminergic neurons in the substantia nigra of the midbrain, and it is also the second most common degenerative disease of the central nervous system. According to relevant statistics, the incidence of PD is nearly 2% among people over 65 years old. With the development of population aging in my country, the number of Parkinson's disease patients is increasing year by year, which brings a heavy burden to families and society. There are many pathogenic factors of PD, including genetic factors and e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K49/00C12N15/09A01K67/027
Inventor黄芳余梅卞敏娟孙凤艳盛哲津
OwnerFUDAN UNIV