Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular mark interlinked with whitebacked planthopper resistance genes of rice, and developing method thereof

A technology of molecular markers and white-backed planthoppers, applied in the field of agricultural biotechnology engineering, can solve problems such as practical application difficulties and difficult selection of markers, and achieve strong resistance to brown planthoppers and strong resistance

Inactive Publication Date: 2011-05-04
CHINA NAT RICE RES INST
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

McCouch was the first to carry out molecular mapping research on rice white-backed planthopper resistance. He first used the TN1 (Taichung Local No. 1) / IR36 near-isogenic line to map Wbph1 between two RFLP markers RG146 and RG445, but due to the RFLP The marker is a multi-copy marker, and it is difficult to be used as a selection marker; since then, Wbph2 and Wbph6(t) have also been mapped successively, but their genetic distances are 25.6cM and 21.2cM, respectively, and practical application is still very difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular mark interlinked with whitebacked planthopper resistance genes of rice, and developing method thereof
  • Molecular mark interlinked with whitebacked planthopper resistance genes of rice, and developing method thereof
  • Molecular mark interlinked with whitebacked planthopper resistance genes of rice, and developing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1. Using SSR molecular markers to obtain the molecular marker RM6917 linked to the rice resistance to white-backed planthopper gene:

[0049] The specific method is: the parent of the insect-resistant gene donor comes from the japonica rice variety Chunjiang 06 (CJ06) of the China Rice Research Institute, and it is crossed with the common indica rice variety Taichung Local No. 1 (TN1) that is susceptible to insects. Crossing and selfing, the obtained insect-resistant and susceptible isogenic lines were used for matching and gene mapping, and 76 recessive individuals were identified from the offspring of this population for linkage analysis.

[0050] In all the following steps, deionized water was used as the solution if not mentioned in detail.

[0051] 1. DNA extraction

[0052] 1) Prepare DNA extraction buffer:

[0053] Add 1 volume of DNA extraction solution (0.35M sorbitol; 0.1M Tris, pH8.2; 0.005MEDTA;), 1 volume of nuclear lysate (0.2M Tris, pH7.5; 0.05M...

Embodiment 2

[0082] Embodiment 2: Obtain the molecular marker AP4741 plant material linked with the rice anti-white-backed planthopper gene with STS molecular markers. The specific method is as follows:

[0083] 1. DNA extraction

[0084] 1), first prepare the DNA extraction buffer:

[0085] With embodiment 1.

[0086] 2), each kind of paddy rice leaf is carried out as follows processing respectively:

[0087] With embodiment 1.

[0088] 2. STS analysis:

[0089] Design of STS primers According to the results of Nipponbare and 93-11 sequence alignment, suitable primers were designed for polymorphism screening of CJ06 and TN1, and Shanghai Shenneng Gaming Company was commissioned to synthesize and design 3 pairs of STS primers, as shown in Table 2:

[0090] Table 2, 3 pairs of STS primer sequences synthesized

[0091] Primer name

left primer sequence

right primer sequence

AP4687

AGCTTCCCCACGACTCCC

GAGCCACACCGCCTCCAC

AP4741

AATCATGCTAGGTTATTACT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular mark linked with rice gene resistant to Whitebacked Planthopper. Rice is selected, and a molecular mark primer is selected from following primer pairs, wherein the nucleotide sequence is 5' arrow 3'; RM6917 forward: CTGGTTGTTTTCTGAACTCCGT, reverse: GCATTAACCATAGCTGTCCACTC; and AP4741 forward: AATCATGCTAGGTTATTACTCG, reverse: GTGCAGAGATCATGCTTTTG. The invention also provides the development method of the molecular mark. The molecular mark is tightly linked with the gene resistant to Whitebacked Planthopper, and can be used for auxiliary selection and breeding of rice resistant to Whitebacked Planthopper.

Description

technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker linked with a rice white-backed planthopper resistance gene and an obtaining method thereof. Background technique [0002] Rice white-backed planthopper (Sogatella furcifera, Horváth) is one of the main pests in rice-producing areas of my country and Southeast Asia. Planthoppers have become the main pests of rice. According to the Chinese Agricultural Yearbook, in the year when the rice planthopper reappears, the affected area exceeds 50% of the total rice area in my country. In 1991, the large-scale damage caused by rice planthoppers in my country caused the loss of nearly 1.6 billion kilograms of rice, and the damaged area reached 29.33 million ha 2 ; In 2005, rice planthoppers broke out again, and combined with the superimposed effect of rice leaf rollers, rice planthoppers caused more than 260 million mu of damage. Therefore, the preven...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/11C12N15/10
Inventor 曾大力李家洋钱前胡江张光恒郭龙彪董国军刘坚
Owner CHINA NAT RICE RES INST