Hepatitis B virus complete-genome polymerase chimera and its construction process and application

A hepatitis B virus, whole genome technology, applied in the field of hepatitis B virus whole genome polymerase chimera and its construction, can solve the problem of failing to find the significance and replication characteristics of the P gene

Inactive Publication Date: 2008-11-26
FUDAN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Subsequently, different scholars used genome, gene fragment sequencing or point mutation techniques to study the mutations in different parts of the hepatitis B virus genome and the changes in replication characteristics in different hepatitis B patients or patients with liver cancer, but they failed to find the mutations in the P gene. Other meaningful changes related to replication features

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hepatitis B virus complete-genome polymerase chimera and its construction process and application
  • Hepatitis B virus complete-genome polymerase chimera and its construction process and application
  • Hepatitis B virus complete-genome polymerase chimera and its construction process and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Since the genome sequence of each HBV strain is not the same, we can only select strains with similar sequences or suitable restriction sites, or strains that can undergo fusion PCR after PCR amplification to replace the P gene and its fragments. The following is an example of the steps and results of the replacement design of the P gene and its fragments from a high-replication strain to a low-replication strain.

[0025] Select two HBV high (#56) and low (#2-18) replication strain genomes from the serum of Chinese hepatitis B patients to obtain the SP fragment of the P gene, and replace the SP of #2-18 with the SP of #56. Two HBV strains from two chronic hepatitis B patients, both of genotype B and serotype adw2, were cloned for the whole genome and transfected into HepG2 liver cancer cell lines to confirm that they were high replication type#56 and low replication type# 2-18. After measuring the nucleotide sequence of the whole gene, it was found that there were 42 ...

Embodiment 2

[0028] Primers were designed to amplify the TP fragment in the polymerase gene, and the TP fragment of #56 was replaced and cloned into #2-18 to form a chimera.

[0029] The primers designed in this experiment are P1, P2, P5, P6. Among them, P1 is the pUC universal reverse primer, and P2, P5, and P6 are HBV specific primers. The primer sequences are as follows:

[0030] P1: 5'AGCGGATAACAATTTCACACAGGA 3'

[0031] P2: 5'AGACCACCAAATGCCCCTATC 3' (2299-2319nt)

[0032] P5: 5'GATAGGGGCATTTGGTGGTCT 3' (2299-2319nt)

[0033] P6: 5'CTGAGTTGGCTTTGAATGCAGG 3' (2948-2971nt)

[0034] Chimera construction strategy:

[0035] P1 and P5 use p2-18 (pUC19 recombinant vector containing low replication strain #2-18) as template to amplify about 580bp fragment, P2 and P6 use p56 (containing high replication strain #56 pUC19 recombinant vector) as template, A fragment of about 580bp was amplified. The two amplified fragments were slowly annealed through the complementary P2 and P5 sequences,...

Embodiment 3

[0038] Construction of chimeric genomes replacing #2-18 holopolymerase (P) genes with #56 holopolymerase (P) genes

[0039] On the basis of the above 2-18TP, the entire polymerase gene of #56 was replaced and cloned into #2-18 to form a chimera.

[0040] Plasmid p2-18TP was double digested with BstEII and RsrII, and a large fragment of 4.0 Kb was recovered. The fragment had removed 2-18 Spacer, RT, and RNaseH, and only contained 2-18 TP. p56 was digested with the same double enzymes, and a fragment of about 2.0Kb was recovered, containing only #56Spacer, RT, RNaseH but not 56d1TP. Connect the above two recovered fragments and convert DH 5α bacteria and screened. The #2-18 chimera containing the full polymerase gene of #56 was confirmed by enzyme digestion and sequence determination (referred to as 2-18P)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the genetic engineering field and utilizes the gene and segments of the replacement virus polymerase (P) to construct and reconstruct a chimera in the complete genome of hepatitis B viral strains and also uses cell transfection technology to analyze the replication function. According to the strains, the invention codes a nucleotide sequence of the polymerase and designs different primers. Combined with endonuclease digestion and polymerase chain reaction, the invention replaces the polymerase genes and gene segments between the genome of hepatitis B viral strains and analyzes the replication function of the newly composed polymerase chimera genome. The method of the invention can be used for searching new functional areas in the polymerase and designing corresponding medicines or diagnose products for restraining the replication of the hepatitis B virus.

Description

[0001] This application is a divisional case of invention name: Hepatitis B virus whole genome polymerase chimera and its construction method and application, application number: 01105685.1, application date: March 15, 2001. technical field [0002] The invention belongs to the field of virus genetic engineering, and in particular relates to a whole genome polymerase chimera of hepatitis B virus and its construction method and application. Background technique [0003] Hepatitis B virus (HBV) belongs to Hepadnaviridae, which has unique gene structure and biological characteristics. The genome of the virus is double-stranded circular DNA, but there is a single-stranded region. The genome of HBV is approximately 3200 base pairs (bp) long, but the positive and negative strands differ in length. The negative strand has a fixed length, ie about 3200 bp. The genome of HBV has 4 coding regions, envelope gene (S / pre-S), core gene (C / pre-C), polymerase gene (P) and X gene. The P g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/09C12N15/52
Inventor 闻玉梅林旭袁正宏
Owner FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap