Unlock instant, AI-driven research and patent intelligence for your innovation.

Cultivating method for improving cotton fiber quality

A technology in the sequence and sequence table, which is applied in the field of cultivation to improve cotton fiber quality, can solve the problems of random integration of foreign genes and inability to achieve fixed-point integration.

Inactive Publication Date: 2012-05-16
TSINGHUA UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in the study of transgenic plants, the integration of exogenous genes on chromosomes is random, and fixed-point integration is not yet possible.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cultivating method for improving cotton fiber quality
  • Cultivating method for improving cotton fiber quality
  • Cultivating method for improving cotton fiber quality

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1. Construction and verification of cotton plants transferred to the optimized spidroin protein-encoding gene SPIII

[0071] 1. Optimizing the construction of spidroin protein and its coding gene

[0072] 1. Construction of the optimized spidroin-encoding gene repeat region (SPI-II)

[0073] (1) According to the sequence characteristics of the published spidroin gene and the codon preferred by cotton, four oligonucleotides were designed and synthesized (synthesized by Shanghai Bioengineering Co., Ltd.):

[0074] SP1 (80nt): AGATCTCAAGGTGCTGGAAGAGGTGGGTTGGGTGGACAGGGCGCAGGTGCAGCTGC-CGCTGCTGCAGCTGAAGGTGCTGG;

[0075] SP2 (49nt): GGATCCAAGCCCACCATAGCCACCCTGTCCAGCACCTCCAGCTGCAGCA;

[0076] SP3 (80nt): AGATCTGCTGCAGCTGCAGCCGCTGCAGCTGGTCCTGGAGGTTACGGACCAGGTCA-GCAAGGACCTGGTGGATATGGTCC;

[0077] SP4 (59 nt): GGATCCAGGACCTGAAGGACCTTGCTGTCCTGGACCATATCCACCAGGTCCTTGCT-GAC.

[0078] (2) The above-mentioned SP1 and SP2, SP3 and SP4 oligonucleotides were annealed at 72°C an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for breeding cotton with improved fiber quality. Proteins used by the method are proteins as shown in (a) and (b): (a). proteins which are formed by amino acid sequences shown from a first amino acid residue to a 793rd amino acid residue from the amino terminal in a sequence 2 in a sequence table; and (b). proteins which are derived from the (a) and have the same function, through substitution and / or deletion and / or addition of one or a plurality of amino acid residues of the amino acid sequences shown from the first amino acid residue to the 793rd amino acid residue from the amino terminal in the sequence 2 in the sequence table. The method expresses cobweb proteins in the cotton for the first time, thereby obviously improving the fiber strength of the cotton, improving the fiber quality of the cotton, and providing a novel germplasm material for producing and breeding the cotton. Therefore, the method has important economic use value.

Description

technical field [0001] The invention relates to a cultivation method for improving cotton fiber quality. Background technique [0002] Cotton is the most important natural fiber crop in the world and has an irreplaceable position in human food and clothing activities. With the continuous improvement of spinning technology and the improvement of people's living standards, higher requirements have been placed on cotton fiber quality, especially fiber strength (Liu Jinyuan et al., 2000, Acta Botanica Sinica, 42: 951-955). How to improve the fiber quality as soon as possible while increasing the cotton yield has become a problem that cotton breeders focus on. Because fiber quality and yield are negatively correlated genetically, it is quite difficult to improve cotton fiber quality and yield in a short period of time by relying solely on conventional breeding techniques (Zhang Tianzhen, Acta Cotton Sinica, 2000, 12: 321-326). The development of genetic engineering provides an ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10A01H1/00A01H5/00
Inventor 刘进元秦永华吴蔼民裴炎张恒木乔志新候磊
Owner TSINGHUA UNIV