Pre-T vector, preparation thereof and applications

A vector and resistance gene technology, applied in the field of pre-T vectors, can solve the problems of troublesome preparation of blue-white screening plates, inability to guarantee the end of vector molecules, and high price.

Inactive Publication Date: 2008-12-31
ZHEJIANG UNIV OF TECH
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method has obvious disadvantages: first, it cannot guarantee that 100% of the ends of the carrier molecules can be added with dT, and second, it is difficult to control exactly 1 dT to be added.
This method requires the use of expensive X-gal, and it is troublesome to prepare blue-white screening plates
Second, if the spatial positions of the two XcmI restriction sites are relatively close, the restriction efficiency of the carrier will be affected. Even if the purity of the carrier DNA is high and the quality of the enzyme is also good, there will be a "knife" of the restriction carrier. , this linear vector cannot be ligated with PCR products, but the vector is self-ligated, resulting in the generation of negative clones

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Construction of restriction restriction cassettes

[0027] Using pET28 (or pET39) as a template, use the following two primers for PCR reaction:

[0028] P1 (Forward):

[0029] 5'XXXGGATCCAAGGGTATAATGGGCCTAACTACGGCTACACTA3'

[0030] P2 (Reverse):

[0031] 5'CTCAAGCTTCCAAGGGTATAATGGACCCCCTATTTGTTTATTTTT3'

[0032] The reaction parameters are as follows:

[0033] Pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 30s, annealing at 45°C for 30s, extension at 72°C for 90s, three cycles; then denaturation at 94°C for 30s, extension at 72°C for 90s, 27 cycles

[0034] Enzyme: Taq Plus DNA polymerase

Embodiment 2

[0035] Embodiment 2: the preparation of former T carrier

[0036] The PCR product of Example 1 is connected to the pUCm-T carrier supplied on the market, and the connection system is as follows:

[0037] PCR product 1uL

[0038] pUCm-T 1uL

[0039] 10×T4DNA ligase buffer 3uL

[0040] T4DNA ligase 1uL

[0041] wxya 2 O 24uL to a total volume of 30uL

[0042] Connect at 14-16°C for more than 10 hours to transform E.coli DH5α (or JM109).

Embodiment 3

[0043] Embodiment 3: Preparation of T carrier

[0044] The positive transformant plasmid of Example 2 was extracted by the alkali-SDS method, purified by a plasmid DNA recovery kit, and digested with XcmI. The enzyme digestion system is as follows:

[0045] Plasmid 2uL

[0046]10×NEB buffer 2uL

[0047] XcmI(5u / uL) 0.5uL

[0048] wxya 2 O to a total volume of 20uL

[0049] Enzyme digestion reaction at 37°C for more than 2 hours, the carrier DNA fragment and the DNA fragment containing the kana resistance gene were separated by 0.8% agarose gel electrophoresis, and the large fragment DNA was recovered by cutting the gel to obtain the T for rapid cloning of the target PCR product. carrier.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a pre-T-vector, which is prepared by the following method. (1) Plasmids of resistant genes of sensitive antibiotics of escherichia coli without containing ampicillin are taken as templates to conduct PCR amplification; XcmI restriction enzyme sites are introduced into terminals of a primer 5`; and DNA fragments are obtained by amplification which contain the resistant genes of the antibiotics, and the upstream and the downstream of the DNA fragment express regulation sequences, and the two terminals of the DNA fragment contain the XcmI restriction enzyme sites. (2) The DNA fragments obtained in procedure (1) are connected with a pUCmT vector by a joining enzyme T4DNA. (3) The connected product obtained in procedure (2) is transformed into escherichia coli DH5 Alpha or JM109; and positive clones are screened, and then the pre-T-vector can be obtained. The pre-T-vector has the following advantages that vectors prepared by the pre-T-vector can be used to clone the product PCR quickly, and X-gal is not needed in the process of screening the positive clones with low negative rate.

Description

(1) Technical field [0001] The invention relates to a pre-T vector which can be used for rapid cloning of PCR products and its preparation and application. (2) Background technology [0002] PCR technology is a basic technology in molecular biology and genetic engineering research, and it is widely used in vitro to amplify known or unknown specific DNA fragments. Rapid and effective cloning of PCR products is the only way to carry out downstream experiments such as hybridization analysis, high-quality sequencing, and separation of target fragments from complex PCR products, so as to realize multiple uses of PCR products. T-vector is a new type of vector developed in recent years for direct cloning of PCR products. T-carriers are generally linear, with a 3'dT (deoxythymidine) protrusion at each end of the molecule. Using the terminal transferase activity of Taq DNA polymerase, a nucleotide, usually deoxyadenylic acid (dA), is added to the 3' end of the amplified DNA in a te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/66
Inventor林陈水于真真许明任慧颖杨丹燕
OwnerZHEJIANG UNIV OF TECH