Granulocyte-macrophage colony stimulating factor gene modified allogene tumour cell vaccine

A technology for tumor cell and gene modification, which is applied to cells modified by introducing foreign genetic material, antineoplastic drugs, DNA/RNA fragments, etc. Efficiency differences, etc.

Inactive Publication Date: 2009-01-28
TIANJIN TUMOR HOSPITAL
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Autologous tumor cells have been used as vaccines in clinical trials, but there are several problems in large-scale clinical use: autologous tumor vaccines need to be prepared from patient tumor tissues, case selection and treatment times are limited by materials, and the cost is relatively high. High; primary tumor cells have great difficulties in in vitro culture and gene transfection operations; tumor cells from different patients have great differences in genetic traits, gene transfection efficiency, etc., and it is difficult to quality control, etc., these Factors limit its widespread use
[0005] So far, there have been no reports at home and abroad about the application of GM-CSF gene transfection to allogenic tumor cell lines to prepare tumor vaccines and its mechanism research and the combination of tumor vaccines and radiotherapy and chemotherapy for the treatment of lung cancer. Studies Prove Its Effectiveness in Active Immunization of Tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Granulocyte-macrophage colony stimulating factor gene modified allogene tumour cell vaccine
  • Granulocyte-macrophage colony stimulating factor gene modified allogene tumour cell vaccine
  • Granulocyte-macrophage colony stimulating factor gene modified allogene tumour cell vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: Cloning of GM-CSF gene

[0029] 1.1 Amplification of GM-CSF gene

[0030] First, take 100 mg of human spleen tissue frozen at -80°C, such as "Molecular Cloning: A Laboratory Guide" by Sambrook et al., second edition, 1989, "Current Protocols In Molecular Biology Experiments" edited by F.M.Ausubel et al. ) (1987) described total tissue RNA extraction.

[0031] Then, use this as a template to design primers for RT-PCR experiments. The coding sequence of human GM CSF gene was searched in GenBank to determine the amplified region. GM-CSF gene coding sequence CDS (33-467, gi:27437029). Primer design using Olig6 software:

[0032] Outer upstream primer P1 5'GGCTAAAGTTCTCTGGAGGATGTG 3' (SEQ ID NO: 1)

[0033] Outer downstream primer P2 5'CTCATCTGGCCGGTCTCACTC 3' (SEQ ID NO: 2)

[0034] Internal upstream primer P3 5' GAATTC ATGTGGCTGCAGAGCCTG 3' (SEQ ID NO: 3)

[0035] Inner downstream primer P4 5' GGATCC TCACTCCTGGACTGGCTC 3' (SEQ ID NO: 4)

[0036] T...

Embodiment 2

[0060] Example 2: Preparation of GM-CSF Gene Modified Allogenic Tumor Cell Lines

[0061] Transfection method

[0062] Tumor cells in good condition were treated with 1.5×10 6 Inoculate / well in a 35mm six-well plate with 2ml of RPMI 1640 culture solution containing 10% fetal bovine serum at 37°C, 5% CO 2 1. Cultivate for 18-24 hours, so that 90-95% of the cells are in contact with each other on the day of transfection.

[0063] For each transfection well, prepare liposome complexes as follows:

[0064] DNA dilution preparation: Dissolve 4 μg of DNA from Example 1 in 250 μl Opti- I In antibiotic-free, serum-free medium, mix gently; liposome dilution preparation: mix LipofectamineTM 2000 gently before use, take 10μl and use Opti- Dilute to 250 μl in antibiotic-free, serum-free medium and mix gently. After incubating at room temperature for 5 minutes, the liposome dilution and the DNA dilution were mixed together and incubated at room temperature for 20 minutes to form a...

Embodiment 3

[0076] Embodiment 3: Preparation and inoculation of mouse tumor vaccine

[0077] The experimental mice are clean inbred strain C57BL / 6 (H-2Kb, female), 8-12 weeks old, weighing 18-22 g, purchased from Beijing Weitong Lihua Animal Center.

[0078] Using C57 mice inoculated with Lewis Lung Cancer (LLC) as an animal model, LLC and LA795 cells were used to prepare GM-CSF gene-modified autologous and allogeneic tumor vaccines, respectively, as described in Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an allogenic tumor cell line which is modified by GM-CSF gene, and the application in the preparation of tumor vaccine; the invention discloses an allogenic tumor cell line which is modified by the GM-CSF gene, and the application in the preparation of the tumor vaccine.

Description

field of invention [0001] The invention relates to a heterogeneous tumor cell line modified with a granulosa-macrocytic colony-stimulating factor (hereinafter referred to as GM-CSF) and its use in preparing tumor vaccines. Background of the invention [0002] In recent years, with the continuous development of immunology, molecular biology and other technologies, we are pleased to note that tumor vaccines have come to the forefront of tumor treatment and have brought hope to patients. The use of self-inactivated tumor cells as antigens to treat tumors has a history of hundreds of years, but the efficacy has been poor. In recent years, great progress has been made in the treatment of self-inactivated tumor cells combined with cytokines. The general method is to transfer the cytokines from the patient's own tumor cells through gene carriers to become tumor cells that can secrete cytokines, and then treat them via Lethal doses of radiation followed by intradermal or subcutaneo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/62A61K35/12A61P35/00A61K35/13
Inventor任秀宝李慧郝希山
OwnerTIANJIN TUMOR HOSPITAL