Preparation of novel tuberculosis vaccine and use thereof

A technology of Mycobacterium tuberculosis and virus vectors, applied in the field of bioengineering and immunization, can solve the problems that cannot be applied to immunodeficiency patients, adults have no protective effect, and the immune effect is insufficient.

A technology of Mycobacterium tuberculosis and virus vectors, applied in the field of bioengineering and immunization, can solve the problems that cannot be applied to immunodeficiency patients, adults have no protective effect, and the immune effect is insufficient.

CN101376891AActive Publication Date: 2009-03-04SHANGHAI INST OF BIOLOGICAL PROD CO LTD

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation of novel tuberculosis vaccine and use thereof
  • Preparation of novel tuberculosis vaccine and use thereof
  • Preparation of novel tuberculosis vaccine and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0110] The construction of embodiment 1.pIL-2 recombinant plasmid

[0111] 1. Obtain and amplify IL-2 (480bp) fragment by PCR

[0112] IL-2 forward primer: gcgcatgcatgtacaggatgcaactcctg (SEQ ID NO: 10)

[0113] IL-2 reverse primer: gcaagcttacttaattatcaagtcagtg (SEQ ID NO: 11)

[0114] Template: human IL-2 DNA fragment or human cDNA prepared by conventional methods.

[0115] PCR reaction system: (μl)

[0116] template forward primer reverse primer 10×Tag buffer 10mM dNTPs 25mM MgCl 2 wxya 2 o Tag enzyme 1 1 1 5 1 3 37 1

[0117] PCR reaction conditions: 94°C for 5 minutes → (94°C for 30 seconds → 56°C for 30 seconds → 72°C for 90 seconds) 30 cycles → 72°C for 10 minutes

[0118] Recovery of PCR products: PCR product rapid purification kit (Broadtech) was used for gel cutting and recovery to obtain 40 μl of IL-2 (480 bp) fragments.

[0119] 2. Insert the target fragment into the expression plasmid to construct the recombinant plasmid...

Embodiment 2

[0133] Construction of embodiment 2.pESAT6 recombinant plasmid

[0134] 1. Obtain and amplify ESAT6 (380bp) fragment by PCR

[0135] ESAT6 forward primer (SEQ ID NO: 12): gcgcatgcatggatgcaatgaagagagggctctgctgtgtgctgctgctgtgtggagcagtcttcgtttcgcccagcacagagcagcagtggaatttc

[0136]ESAT6 reverse primer (SEQ ID NO: 13): gcaagcttcgttgccctatgcgaacatcc

[0137] Template: Mycobacterium tuberculosis H37Rv genome

[0138] PCR reaction system: (μl)

[0139]

template

forward primer

reverse primer Contains MgSO 4 10×

Pfu buffer

10mM dNTPs

wxya 2 o

Pfu enzyme 1 1 1 5 1 40 1

[0140] PCR reaction conditions: 95°C for 5 minutes → (95°C for 30 seconds → 60°C for 30 seconds → 72°C for 60 seconds) 30 cycles → 72°C for 10 minutes

[0141] Recovery of PCR products: PCR product rapid purification kit (Broadtech) was used for gel cutting and recovery to obtain 40 μl of ESAT6 (380 bp) fragments.

[0142] In addition, the 380bp of ESAT...

Embodiment 3

[0159] Example 3. Construction of pIRES-IL-2 recombinant plasmid

[0160] 1. Obtain and amplify the IRES (650bp) fragment by PCR

[0161] IRES forward primer (SEQ ID NO: 14): GCGTCGACCCGAAGTAACTTAGAAGCTG

[0162] IRES reverse primer (SEQ ID NO: 15): GCGCATGCATGTTTGATTGTGTTGAGGG

[0163] Template: Commercially available plasmid containing ribosome entry site IRES

[0164] PCR reaction system: (μl)

[0165]

template

forward primer

reverse primer

Contains MgSO 4 10 x Pfu buffer

liquid

10mM dNTPs

wxya 2 o

Pfu enzyme

1 1 1 5 1 40 1

[0166] PCR reaction conditions;

[0167] 95°C for 5 minutes → (95°C for 30 seconds → 65°C for 30 seconds → 72°C for 1.5 minutes) 30 cycles → 72°C for 10 minutes

[0168] Recovery of PCR products: PCR product rapid purification kit (Broadtech) was used for gel cutting and recovery to obtain 50 μl of IRES (650 bp) fragments.

[0169] 2. Insert the target fragment into...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant virus carrier which can co-express tubercle bacillus Ag85a, ESAT6 and / or Ag85a / ESAT6 fusion protein as well as any immune auxiliary factor; an expression cassette containing at least one type of tubercle bacillus Ag85a coding sequence, ESAT6 coding sequence and Ag85a / ESAT6 fusion protein coding sequence and the any immune auxiliary factor coding sequence is inserted into a gene group DNA of the recombinant virus carrier. The invention also relates to a host cell containing the virus carrier, a pharmaceutical composition and a preparation method thereof. The recombinant virus carrier can co-express a plurality of antigens of m.tuberculosis and / or cell factors, and has improved prevention and / or curing effect to tuberculosis.

Description

technical field [0001] The invention relates to the fields of bioengineering and immunization, in particular to a novel tuberculosis vaccine and a preparation method thereof. Background technique [0002] In the past 20 years, tuberculosis, which was once controlled at a very low level, is showing a resurgent trend worldwide. There are currently 20 million tuberculosis patients in the world, 95% of whom are in developing countries. If not controlled, 300 million people will be infected by Mycobacterium tuberculosis in the next 10 years. To this end, the World Health Organization declared a global tuberculosis emergency in 1993, and reiterated its action to curb tuberculosis in 1998. [0003] The causative bacterium of tuberculosis is Mycobacterium tuberculosis, which belongs to the Actinomycetes Mycobacteriaceae Mycobacterium genus. Mycobacterium tuberculosis is mainly transmitted through the respiratory tract, and can also enter the human body through the digestive tract....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
04 Mar 2009
Publication
CN101376891A
IPC
C12N15/86; A61K39/04; A61P31/06
Inventors
楼觉人; 朱琳