Method for detecting flu and H5N1 avian influenza virus by using liquid chip

A technology of liquid phase chip detection and avian influenza virus, which is applied in the field of medical detection, can solve the problems of long detection time and inability to detect, and achieve the effect of detecting many types of viruses

Inactive Publication Date: 2009-03-25
JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
View PDF2 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method can only quickly detect H5N1 subtypes, and cannot simultaneously detect H1N1, H3N2 and other influenza A viruses and influenza B viruses at the same time, and requires two rounds of PCR reactions, which takes a long time to detect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting flu and H5N1 avian influenza virus by using liquid chip
  • Method for detecting flu and H5N1 avian influenza virus by using liquid chip
  • Method for detecting flu and H5N1 avian influenza virus by using liquid chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The first step: design primers and probes, use bioinformatics knowledge and bioinformatics software to pass through the gene segment sequences of all influenza A viruses H5, N1 and NP in the nucleic acid database and the HA gene segment sequences in influenza B viruses The computer performs homology comparison, and designs degenerate primers and specific probes for each gene according to the conserved sequence; the obtained degenerate primers are as follows:

[0038] FluA-Reverse GGTCTTGTCTTTAGCCAYTCCAT

[0039] H5-Forward GGTAACGGTTGTTTCGARTTCTATCA

[0040] H5-Reverse ATAGACCAGCYACCATGATTGCCAG

[0041] N1-Forward GGACYAGTGGGAGCAGCATA

[0042] N1-Reverse TGTCAATGGTRAAYGGCAACTC

[0043] FluB-Forward AAATACGGTGGATTAAATAAAAGCAA

[0044] FluB-Reverse CCAGCAATAGCTCCGAAGAAA;

[0045] The resulting specific probes are as follows:

[0046] FluA-probe TCAGGCCCCCTCAAAGCCGA

[0047] H5-probe CCGCAGTATTCAGAAGAAGC

[0048] N1-probe TGGTCTTGGCCAGACGGTGC

[0049] FluB-probe G...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for detecting influenza viruses, in particular to a method for detecting influenza viruses and H5N1 subtype avian influenza virus by a liquid-phase chip, belonging to the technical field of medical monitoring. The method is a fast and highly efficient one which can identify FluA and FluB influenza viruses including the H5N1 subtype avian influenza virus by types. With the utilization of a liquid-phase chip technology and the application of bioinformatics knowledge and related bioinformatics software, the liquid-phase chip which can specifically distinguish H5 and N1 gene fragments, NP gene fragment of the FluA influenza virus and HA gene fragment of the FluB influenza virus is manufactured. The method has the advantages that fast detecting and early-stage diagnosis of the FluA and the FluB influenza viruses including the H5N1 subtype highly pathogenic avian influenza virus can be carried out; and a basis for developing other fast and highly effective detecting methods for detecting various subtype influenza viruses is provided. The method is characterized by detecting multiple types of viruses, short response time and high sensitivity, thus determining that the method has wide application prospect.

Description

technical field [0001] The invention relates to a method for detecting viruses, in particular to a method for detecting influenza and H5N1 subtype avian influenza viruses by means of a liquid phase chip, and belongs to the technical field of medical detection. Background technique [0002] So far, it has been found that the subtypes of avian influenza viruses that can directly infect humans include H5N1, H7N1, H7N2, H7N3, H7N7 and H9N2, among which the H5N1 subtype poses the greatest threat to humans. In addition, the main influenza viruses that threaten humans include H1N1, H3N2 and other influenza A viruses and influenza B viruses. [0003] At present, the main detection methods of avian influenza virus include three aspects: virus isolation, virus antigen and gene detection, and serological examination. Among them, virus isolation takes a long time and requires high technical requirements, which is not conducive to rapid diagnosis; serological examination can only be use...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 崔仑标葛以跃史智扬曾晓燕焦永军潘浩汪华
Owner JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap