Streptomyces clavuligerus, as well as preparation method and application thereof

A technology of Streptomyces coryneformis and strains, applied in the field of biopharmaceuticals, can solve the problems of low production of clavulanic acid, etc., and achieve the effects of short cycle, strong purpose and low work intensity

Active Publication Date: 2009-05-20
LUNAN PHARMA GROUP CORPORATION
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] In order to solve the problem of low yield of clavulanic acid produced by fermentation of Streptomyces clavulanic acid, one of the purposes of the present invention is to provide a high-yielding strain of Streptomyces clavulanic acid producing clavulanic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptomyces clavuligerus, as well as preparation method and application thereof
  • Streptomyces clavuligerus, as well as preparation method and application thereof
  • Streptomyces clavuligerus, as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Construction of argG gene insertion vector

[0033] Primers were designed according to the DNA sequence of the Streptomyces clavuligerus (Streptomyces clavuligerus) argG gene (Z49111), and the argG gene fragment was amplified in vitro by PCR using the total DNA of Streptomyces clavuligerus, and the PCR product was purified, and then detected by electrophoresis (accompanying drawing 4 ).

[0034] According to the analysis of Streptomyces clavulatus encoding argG gene sequence, two primers for PCR amplification argG gene were designed, respectively as follows:

[0035] argG-up: CGCGGATCCCGTAAGCGTCCGATCACTTCG

[0036] argG-down: CCGGAATTCGCTGCTCACTGCGGGAACT

[0037] The PCR product was double-digested with BamHI and EcoRI, and then inserted into the same double-digested pSET152 plasmid (Figure 2). Positive clones were obtained through blue-white screening, and the plasmid was extracted, verified by BamHI and EcoRI double-digestion, and electrophoresis to detect...

Embodiment 2

[0038] The preparation of embodiment 2 Streptomyces protoplasts

[0039] Protoplast selection of transformed strains

[0040] Add 100ml YEME+TSBY (1:1) and 0.2% glycine to a 250ml Erlenmeyer flask equipped with a stainless steel spring, inoculate 100ul of spore suspension, and incubate at 30°C at 200rpm for 36h-40h. Then the mycelium was collected, and the collected mycelium was washed with 10.3% sucrose solution for three times, and the mycelium was collected by centrifugation at 3000 rpm for 10 min. Take the mycelium, add the P buffer of lysozyme, and put it in a water bath at 30°C for 30-60min until the supernatant becomes milky. Filter with a test tube equipped with absorbent cotton, transfer the filtrate into a sterile universal, and centrifuge at 3000rpm for 7min to collect the protoplast precipitate, which is yellow. Gently break up the protoplasts, wash with P buffer to remove lysozyme, centrifuge under the same conditions, collect the protoplasts, remove the superna...

Embodiment 3

[0043] Embodiment 3 Shake flask detection of genetically engineered bacteria

[0044] Shake flask experiments were carried out on the screened engineered bacteria to detect their ability to produce clavulanic acid. The original strain was used as the control strain, soybean medium was selected as the fermentation medium, the liquid volume of the shake flask was 1:10, the inoculum volume was 5%, cultured at 28°C, 250rpm, samples were taken at different times to detect the content of clavulanic acid . Each experiment had two repetitions. The results of HPLC detection showed that compared with the original strain, the output of Streptomyces clavulatus LNSC-02 had been greatly improved, which was increased by 20% at 72 hours (accompanying drawing 5, accompanying drawing 6).

[0045] Table 1 The content of clavulanic acid in the fermentation broth detected by HPLC

[0046]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of microbial engineering, provides a superior streptomyces clavuligerus strain that is used for clavulanic acid production, a strain preparation method and application of the strain, and concretely relates to a method, which obtains high expression of key enzyme in the arginine synthesizing process by increasing the copy number of clavulanic acid synthesizing precursor of the streptomyces clavuligerus strain that is key enzyme gene argG in the arginine synthesizing process, and then obtains the streptomyces clavuligerus strain LNSC-2 with high yield of clavulanic acid. Compared with the original strains, the superior streptomyces clavuligerus strain that is provided by the invention can improve the yield of the zymolytic clavulanic acid production by over 20 percent.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, and relates to a streptomyces clavulus, in particular to a streptomyces clavulus constructed by a genetic engineering method. The invention also relates to the preparation method and application of the Streptomyces clavulus. Background technique [0002] β-lactam antibiotics, such as penicillins, cephalosporins, and cephalosporins, are the most widely used antibiotics in clinical practice. However, due to the emergence of pathogenic bacteria resistance, the use of such antibiotics has been greatly affected. The main reason for the drug resistance of pathogenic bacteria is the β-lactamase produced by it, which inactivates the β-lactam ring of β-lactam antibiotics by destroying them. Clavulanic acid is a natural β-lactamase inhibitor produced by Streptomyces clavulicularis, which can irreversibly bind to the serine active site of β-lactamase to protect the activity of β-lactam antibiotics. Clin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P17/18C12R1/465
Inventor赵志全
OwnerLUNAN PHARMA GROUP CORPORATION