Oligonucleotide and uses thereof
An oligonucleotide and tongue squamous cell carcinoma technology, applied in the field of biomedical materials, can solve the problems of no significant improvement, poor curative effect, and low survival rate of advanced patients
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] The extraction of embodiment 1 total RNA and miRNA (mirVana TM microRNA extraction kit, Ambion company)
[0058] 1 Add 600μl Lysis / Binding Solution to lyse the tissue;
[0059] 2 Add microRNA Homogenate Additive at 1 / 10 the volume of the lysate, mix well, and place on ice for 10 minutes;
[0060] 3 Add the same volume of phenol:chloroform solution as the lysate (without adding microRNA Homogenate Additive), mix well, and centrifuge at the maximum speed (10,000×g) for 5 minutes at room temperature;
[0061] 4 Transfer the supernatant to a clean tube and note down the volume of the liquid;
[0062] 5 Add 1 / 3 volume of 100% alcohol to the supernatant and mix thoroughly;
[0063] 6 Add the lysate / alcohol mixture to the Filter Cartridge column, centrifuge at ~10,000×g for 15s, and collect the filtrate;
[0064] 7. The main thing retained on the Filter Cartridge column is macromolecular RNA, and the retained RNA is recovered according to the standard procedure of total R...
Embodiment 2
[0072] Preparation of embodiment 2cDNA (miRNA reverse transcription):
[0073] The miRNA extracted in Example 1 was reverse-transcribed to prepare a cDNA template (reverse transcription primer sequences are shown in Table 1).
[0074] A: Reverse transcription reaction system:
[0075] Reagent name (both buffer and enzyme are
promega company)
Dosage / tube
5×Reverse Transcription buffer
(buffer)
4ul
RT Primer Mix (1uM) (primer mixture)
1.25ul
dNTP (10mM) (four deoxyribonucleotides
Mixture)
0.75ul
RNA (template)
2ul
RTase (200U / ul) (reverse transcriptase)
0.5ul
DEPC H2O
to 20ul
[0076] B: Reverse transcription reaction conditions:
[0077] The reaction conditions are: 16°C for 30min; 42°C for 30min; 85°C for 10min.
Embodiment 3
[0078] Embodiment 3 Dye method fluorescent quantitative PCR detection
[0079] A: Dilution of cDNA template:
[0080] The cDNA obtained after reverse transcription in Example 2 was diluted 3 times, for example: add 40 μl RNase / DNase free ddH2O to 20 μl system, and mix well.
[0081] B: Dye method fluorescent quantitative PCR system:
[0082] Reagent name
Dosage / tube
2×Real-time PCR Master Mix
10μl
PCR Forward Primer (10uM)
0.2μl
PCR Reverse Primer (10uM)
0.2μl
DNA / cDNA Template
2μl
Taq DNA polymerase (5U / μl)
0.2μl
dd H 2 o
To 20μl
[0083] Among them, the primers used by U6 are F Primer: ATTGGAACGATACAGAGAAGATT; R Primer: GGAACGCTTCACGAATTTG.
[0084] The primers used for miR-21 detection are:
[0085] First group:
[0086] RT Primers:
[0087] 5’-GTCGCAATCCATGAGAGATCCCTACCGACATGGATTGCGACTCAACA
[0088] Forward Primer: 5'-GCGGTAGCTTTATCAGACTGATGT-3'
[0089] Reverse Primer: 5'-...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com