Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Oligonucleotide and uses thereof

An oligonucleotide and tongue squamous cell carcinoma technology, applied in the field of biomedical materials, can solve the problems of no significant improvement, poor curative effect, and low survival rate of advanced patients

Active Publication Date: 2011-08-10
SUZHOU GENEPHARMA +2
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the past 30 years, although the comprehensive treatment of tongue squamous cell carcinoma has been very common clinically, the comprehensive treatment based on surgery and supplemented by radiotherapy and chemotherapy has not significantly improved the survival rate of tongue squamous cell carcinoma, and the 5-year overall survival rate is still relatively low. Low, hovering around 30% to 55%, without significant improvement, the 5-year survival rate of middle and advanced patients is even lower, about 27%
Moreover, these methods have their own limitations, especially for the middle-advanced and relapsed patients, and the curative effect is even worse for those with distant metastasis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide and uses thereof
  • Oligonucleotide and uses thereof
  • Oligonucleotide and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] The extraction of embodiment 1 total RNA and miRNA (mirVana TM microRNA extraction kit, Ambion company)

[0058] 1 Add 600μl Lysis / Binding Solution to lyse the tissue;

[0059] 2 Add microRNA Homogenate Additive at 1 / 10 the volume of the lysate, mix well, and place on ice for 10 minutes;

[0060] 3 Add the same volume of phenol:chloroform solution as the lysate (without adding microRNA Homogenate Additive), mix well, and centrifuge at the maximum speed (10,000×g) for 5 minutes at room temperature;

[0061] 4 Transfer the supernatant to a clean tube and note down the volume of the liquid;

[0062] 5 Add 1 / 3 volume of 100% alcohol to the supernatant and mix thoroughly;

[0063] 6 Add the lysate / alcohol mixture to the Filter Cartridge column, centrifuge at ~10,000×g for 15s, and collect the filtrate;

[0064] 7. The main thing retained on the Filter Cartridge column is macromolecular RNA, and the retained RNA is recovered according to the standard procedure of total R...

Embodiment 2

[0072] Preparation of embodiment 2cDNA (miRNA reverse transcription):

[0073] The miRNA extracted in Example 1 was reverse-transcribed to prepare a cDNA template (reverse transcription primer sequences are shown in Table 1).

[0074] A: Reverse transcription reaction system:

[0075] Reagent name (both buffer and enzyme are

promega company)

Dosage / tube

5×Reverse Transcription buffer

(buffer)

4ul

RT Primer Mix (1uM) (primer mixture)

1.25ul

dNTP (10mM) (four deoxyribonucleotides

Mixture)

0.75ul

RNA (template)

2ul

RTase (200U / ul) (reverse transcriptase)

0.5ul

DEPC H2O

to 20ul

[0076] B: Reverse transcription reaction conditions:

[0077] The reaction conditions are: 16°C for 30min; 42°C for 30min; 85°C for 10min.

Embodiment 3

[0078] Embodiment 3 Dye method fluorescent quantitative PCR detection

[0079] A: Dilution of cDNA template:

[0080] The cDNA obtained after reverse transcription in Example 2 was diluted 3 times, for example: add 40 μl RNase / DNase free ddH2O to 20 μl system, and mix well.

[0081] B: Dye method fluorescent quantitative PCR system:

[0082] Reagent name

Dosage / tube

2×Real-time PCR Master Mix

10μl

PCR Forward Primer (10uM)

0.2μl

PCR Reverse Primer (10uM)

0.2μl

DNA / cDNA Template

2μl

Taq DNA polymerase (5U / μl)

0.2μl

dd H 2 o

To 20μl

[0083] Among them, the primers used by U6 are F Primer: ATTGGAACGATACAGAGAAGATT; R Primer: GGAACGCTTCACGAATTTG.

[0084] The primers used for miR-21 detection are:

[0085] First group:

[0086] RT Primers:

[0087] 5’-GTCGCAATCCATGAGAGATCCCTACCGACATGGATTGCGACTCAACA

[0088] Forward Primer: 5'-GCGGTAGCTTTATCAGACTGATGT-3'

[0089] Reverse Primer: 5'-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a series of oligonucleotides; in fluorescent real-time quantitative PCR reaction, the oligonucleotides can specifically detect the expression of miR-21. On the basis, the invention uses the oligonucleotides to prepare reagents with highly expressed miR-21 for diagnosis, aging and prognosis evaluation of tongue squamous carcinoma. The invention further discloses a kit containing the oligonucleotides, and the kit can be used for diagnosis, aging and prognosis evaluation of tongue squamous carcinoma.

Description

technical field [0001] The present invention relates to the use of a series of oligonucleotides. The oligonucleotides can be used for detecting the expression of micronucleic acid miR-21 by fluorescent real-time quantitative PCR method, and can also be applied to the preparation of diagnosis and staging of tongue squamous cell carcinoma The invention relates to a reagent for evaluating prognosis and belongs to the technical field of biomedical materials. Background technique [0002] Research and analysis of miRNAs suggest that miRNAs are involved in a series of important processes in life, including development, hematopoiesis, organ formation, apoptosis, cell proliferation, and even tumorigenesis. Among many related diseases, abnormal miRNA expression in malignant tumors has attracted the most attention. According to high-throughput miRNA microarray and real-time quantitative RT-PCR (quantitative real-time PCR, qRT-PCR) analysis, it was found that in a variety of human mal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 李劲松宋尔卫张佩琢
Owner SUZHOU GENEPHARMA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com