Malt oligosaccharide based mycose synthetase, coding gene and use

A technology of trehalose synthase and maltooligosaccharide base, applied in the field of maltooligosaccharide base trehalose synthase and its coding gene and application, can solve the problem of high production cost

Active Publication Date: 2009-08-12
FEED RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0014] For a long time, the fundamental reason restricting the wide application of trehalose is the high production cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Malt oligosaccharide based mycose synthetase, coding gene and use
  • Malt oligosaccharide based mycose synthetase, coding gene and use
  • Malt oligosaccharide based mycose synthetase, coding gene and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Embodiment 1, maltooligosaccharide-based trehalose synthase

[0049] 1. Acquisition of maltooligosaccharyl trehalose synthase (MTSase-1) and its coding gene (TreY-1)

[0050] Design PCR amplification primers, upstream primer TreY-1F: 5′ CCATGG ATGGCACGTCCAATTTCC 3′, downstream primer TreY-1R: 5′ CCATGG AAACTCACTATCGGGTACTAAAAC3' wherein NcoI restriction sites were introduced into the upstream and downstream primers respectively, as shown in the underline, so that the target fragment could be inserted into the expression vector pET30a treated with the same restriction enzyme digestion after NcoI restriction.

[0051] Using TreY-1F and TreY-1R as primers, and using Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC1.1886 genomic DNA as a template, a PCR reaction was performed. The reaction conditions were as follows: 5 minutes of pre-denaturation at 94°C, denaturation at 94°C for 20s, annealing at 56°C for 20s, extension at 72°C for 3min and 20s, and 30 cyc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a maltooligosyl trehalose synthase and coding genes and application thereof. The maltooligosyl trehalose synthase is a protein which has one of following amino acid residue sequences: 1) an amino acid residue sequence with the No.1 SEQ ID in a sequence list; and 2) SEQ ID No.1 amino acid residue sequence derivative proteins which are obtained through the substitution and / or deletion and / or addition of one or a plurality of the amino acid residues from or to the SEQ ID No.1 amino acid residue sequence in the sequence list and are additionally provided with the relevant functions of the maltooligosyl trehalose synthase. The maltooligosyl trehalose synthase protein has the activity of the maltooligosyl trehalose synthase. The maltooligosyl trehalose synthase has molecular weight of 90 kDa, an enzyme activity pH range of 7.0 to 9.0, an optimal pH value of 8.0, an enzyme activity temperature range of 20 to 40 DEG C, and an optimal reaction temperature of 35 DEG C.

Description

technical field [0001] The invention relates to a maltooligosaccharide-based trehalose synthetase, its coding gene and application. Background technique [0002] Trehalose is a non-reducing disaccharide composed of two glucopyranose linked by 1,1-glycosidic bonds. There are three optical isomers of trehalose, among which the αβ and ββ types rarely exist in nature, and the αα type is the most common trehalose. The structural formula of the αα type trehalose is shown in Formula I. [0003] [0004] Trehalose is colorless and odorless, with a slightly sweet taste, and its sweetness is equivalent to 45% of that of sucrose. The physical and chemical properties of trehalose are stable, it will not caramelize, it cannot reduce Fehling's reagent, and it cannot be hydrolyzed by α-glucosidase, but it can be hydrolyzed into two glucose molecules by trehalase. [0005] Preparation method of trehalose: Traditional methods include chemical synthesis and microbial extraction, especial...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/00C12N15/52C12N15/63C12N5/10C12N1/00C12R1/15C12R1/19
Inventor丁宏标张文德乔宇
OwnerFEED RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES