Antibody having enhanced adcc activity and method for production thereof

A technology of antibody and humanized antibody, applied in the direction of antibody, anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, hybrid cell preparation, etc., can solve the problem of ADCC activity increase

Inactive Publication Date: 2009-08-26
MEDICAL & BIOLOGICAL LAB CO LTD
View PDF51 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Many researches have been carried out to increase ADCC activity by solving the item of 2)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibody having enhanced adcc activity and method for production thereof
  • Antibody having enhanced adcc activity and method for production thereof
  • Antibody having enhanced adcc activity and method for production thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[1113]Anti-CD20 chimeric antibodies of 293, 294, 298, 299, 300, and 301 Cys types were prepared, and the ADCC activities of these various Cys type Anti-CD20 chimeric antibodies were evaluated. As a result, compared to the ADCC activity of the wild-type Anti-CD20 chimeric antibody, the 294, 298, and 301Cys-type Anti-CD20 chimeric antibodies showed very high ADCC activity.

[1114] The following describes the preparation methods of the wild-type and three variants (294Cys, 298Cys, and 301Cys) of the Anti-CD20 chimeric antibody, as well as its ADCC activity measurement and reactivity to CD20 molecules.

[1115] 1) Production of Anti-CD20 chimeric antibody

[1116] The chimeric antibody undergoes the following steps A) to F) to obtain a purified chimeric antibody.

[1117] A) Cloning of genes necessary for making chimeric antibodies;

[1118] B) The mutation introduction of the cloned gene;

[1119] C) Constructing a chimeric antibody expression vector combining the cloned gene and ...

Embodiment 2

[1392] Cys-type Anti-CD20 chimeric antibodies of 290, 291, 292, 302, and 303 were prepared by the same method as in Example 1, and the ADCC activities of these various Cys-type Anti-CD20 chimeric antibodies were evaluated. As a result, compared with the ADCC activity of the wild-type Anti-CD20 chimeric antibody, the 290, 291, 292, 302, and 303 Cys type Anti-CD20 chimeric antibodies showed very high ADCC activity.

[1393] The following describes the preparation methods of the wild-type and five variants (290Cys, 291Cys, 292Cys, 302Cys, and 303Cys) of the Anti-CD20 chimeric antibody, as well as its ADCC activity measurement and reactivity to CD20 molecules.

[1394] 1) Production of Anti-CD20 chimeric antibody

[1395] The chimeric antibody undergoes the following steps A) to F) to obtain a purified chimeric antibody.

[1396] A) Cloning of genes necessary for making chimeric antibodies;

[1397] B) The mutation introduction of the cloned gene;

[1398] C) Construction of a chime...

Embodiment 3

[1524] (Production of Anti-EGFR Humanized Antibody)

[1525] In order to express wild-type and 298Cys-type Anti-EGFR humanized antibodies in CHO cells, three kinds of expression vectors (Anti-EGFR humanized antibody L chain expression vector, wild-type Anti-EGFR humanized Antibody H chain expression vector, 298Cys type Anti-EGFR humanized antibody H chain expression vector). The details of the construction of each expression vector are described below.

[1526] 1) Construction of Anti-EGFR humanized antibody L chain expression vector

[1527] Using the gene containing the variable and constant regions of the human-type Anti-EGFR antibody L chain as a template, using the primers shown below, a DNA fragment was obtained by PCR.

[1528] EGFR-L1 primer: ACCGCTCGAGATGGACATGAGGGTCCCCGCTCAGCTC (serial number 220)

[1529] EGFR-L2 primer: ATAGTTTAGCGGCCGCTTACGAACATTCTGTAGGGGCCACTGTCTT (serial number 221)

[1530] The DNA fragment obtained in the PCR reaction was purified by ethanol preci...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
absorbanceaaaaaaaaaa
Login to view more

Abstract

The present invention discloses an antibody having an enhanced ADCC activity. Also disclosed is a method for producing the antibody. It was attempted to advance the technique of the amino acid mutation in an Fc region established by researchers of Genentech Inc. or the like, and a study was made on whether or not the ADCC activity can be enhanced by the mutation of an amino acid residue in an Fc region into cysteine (Cys) which may cause a drastic structural change that cannot be drawn by a computational search. As a consequence, a chemeric antibody is provided which has the mutation of an amino acid residue at at least one position selected from the group consisting of 286th, 287th, 288th, 289th, 290th, 291st, 292nd, 294th, 298th, 301st, 302nd, 303rd, 305th, 306th, 307th, 308th and 309th positions into a Cys residue in an H-chain constant region.

Description

Technical field [0001] The present invention relates to a method for enhancing ADCC activity of an antibody and an antibody with enhanced ADCC activity. Background technique [0002] Chimeric antibodies in which the variable region of the antibody is mouse-type and the constant region is human-type, and humanized antibodies in which both the variable region and the constant region are human-type are expected as therapeutic drugs for cancer and chronic rheumatoid arthritis. In the treatment of cancer, chemically synthesized therapeutic drugs such as cisplatin, which have been used all the time, have a low ability to recognize cancer cells and normal cells and are highly toxic. Therefore, the current situation is that chemotherapy for cancer puts a heavy burden on cancer patients. On the other hand, chimeric or humanized antibodies have a function of recognizing specific molecules on the surface of cancer cells, so their toxicity is low and the physical burden is light for patients...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28A61K39/395C12N15/02C12N15/09C12P21/08
Inventor 村上昭弘
Owner MEDICAL & BIOLOGICAL LAB CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap