Method for expressing human osteogenic protein-1 in peanut seeds
An osteogenic protein and peanut technology, applied in the biological field, achieves the effect of simple method, convenient transportation, and stable recombinant protein
Image
Examples
Embodiment 1
[0024] Example 1 Cloning of the soybean oleosin gene comprising a promoter
[0025] According to the sequence of the promoter of soybean oil body protein in NCBI and the gene sequence of oil body protein (gene accession number: GMU09118), the forward primer sequence containing the NcoI restriction site (CCATGG) was designed: primer1: 5'CATGCCATGGTGTTTATCTTTCTTGCTTTTCTG 3'; According to the open reading frame sequence of soybean oil body protein gene, the stop codon was removed, and the reverse primer primer2 with EcoRI restriction site (GAATTC) and enteropeptidase recognition site (TTATCATCATCATC) was designed: 5'CCGGAATTCCCTTATCATCATCATCTGCGGTTGCGGTTGTTGCTGTCA T 3 '.
[0026] Extract the genomic DNA of soybean (Zhonghuang 13), the method is as follows:
[0027] (1) Take 100 mg of young soybean leaves, grind them into powder with liquid nitrogen, or use them directly or store them at -80°C;
[0028] (2) Preheat CTAB extract (0.2M Tris-HCl, pH 9.0; 0.4M LiCl; 25mM EDTA; 1% SDS)...
Embodiment 2
[0042] Example 2 Acquisition of Human Osteogenic Protein Mature Peptide cDNA Gene bmp7
[0043] According to the mature peptide sequence of human osteogenic protein-1 gene in NCBI (gene accession number: NM_001719), primers containing EcoRI site primer3: 5'CCGAATTCATATGACCGGCAGCAAACAG 3' and primer4 with HindIII site: 5'GAAAGCTTGATCC TTACATGTCGCAGCCACAGGC 3' were designed .
[0044] collect 1x10 6 According to the standard procedure of One-Step RT-PCR Kit (Clonetech), the following PCR reactions were carried out: incubation at 45°C for 1h, denaturation at 45°C for 5min, annealing at 51°C for 1min, 72°C extension for 1 min) for 30 cycles, 72°C extension for 7 minutes.
[0045] 5 μL of the PCR product was subjected to 1% agarose gel electrophoresis, the results were observed under ultraviolet light, and positive clones were selected for sequencing (see Sequence Table 4).
Embodiment 3
[0046] The construction of embodiment 3 plant expression vectors
[0047] The construction process of plant expression vector is as follows: figure 1 Shown:
[0048] (1) Linkage of oleosin gene and human osteogenic protein gene (oleo-bmp7)
[0049] The PCR product was digested with the following system:
[0050] PCR product 10.0 μL, 10x Buffer H 3.0 μL, EcoRI 1.0 μL, ddH 2 O 16.0 μL. Incubate at 37°C for 4 hours, perform agarose electrophoresis, and recover oil body protein and osteogenic protein gene fragments respectively.
[0051] Ligate the oleosin gene and the human osteogenic protein gene with T4 DNA ligase: 1.0 μL of 10x T4 DNA ligasebuffer, 4.0 μL of Oleosin, 4.0 μL of Bmp7, and 1.0 μL of T4 DNA ligase. Ligate overnight at 16°C, take 1.0 μL of the ligation product for PCR amplification, the system is as follows: 2x pfu mix 10.0 μl, primer1 (10 μm) 0.5 μl, primer4 (10 μm) 0.5 μl, ddH 2 O 8.0 μl. Set the PCR instrument (TaKaRa TP650) at 94°C for 5 minutes, followe...
PUM
Login to View More Abstract
Description
Claims
Application Information
- IPC
- C12N15/82; C07K14/51; C07K1/14
- Inventors
- 王兴军; 赵传志
