Hsa-mir-210 kit for detecting pregnancy-hypertension syndrome and detecting method thereof
A technology of hsa-mir-210 and gestational hypertension, applied in the field of medical biological detection, can solve the problem of no has-mir-210 and the like, and achieve the effect of reducing the occurrence of gestational hypertension and its related complications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Preparation of the kit of the present invention (for one person)
[0035] The composition of the kit of the present invention is as follows:
[0036] 1. 1 tube of reverse transcription primer, 100μl / tube concentration: 10μM reverse transcription primer:
[0037] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGCCGCT
[0038] 2. 1 tube each of the upstream and downstream primers of Real-time PCR, 100μl / tube concentration: 10μM;
[0039] The upstream primer is: ACGATGCTGTGCGTGTGAC
[0040] The downstream primer is: GTGCAGGGTCCGAGGT
[0041] 3. Trizol reagent 1 tube 2000μl / tube
[0042] 4.Chloroform 1 tube 500ul / tube
[0043] 5. Anhydrous ethanol 1 tube 7ml / tube
[0044] 6.DEPC H 2 O 1 tube 1000μl / tube
[0045] 7.dd H 2 O 1 tube 2000μl / tube.
[0046] The present invention finds the mature body sequence CUGUGCGUGUGACAGCGGCUGA of hsa-mir-210 according to known bioinformatics. Its specific reverse transcription primers and Real-time PCR upstream and downstream primers are all design...
Embodiment 2
[0058] Example 2: Detection of the kit of the present invention
[0059] 1. Collection of plasma samples and sample preparation:
[0060] Because plasma has the advantages of convenient sampling, non-invasiveness, and continuous detection, the detection of biomarkers for pregnancy-induced hypertension from plasma can improve the detection technology of pregnancy-induced hypertension to a new level, thereby achieving early prevention, The purpose of early treatment.
[0061] Plasma samples were collected in the Department of Obstetrics and Gynecology of Shanghai Changhai Hospital and the Department of Obstetrics and Gynecology of the First Affiliated Hospital of Anhui Medical University, and divided into the following four groups: (1) Pregnant women with hypertension in pregnancy (n=10); (2) Mild aura Pregnant women with epilepsy (n=10); (3) pregnant women with severe preeclampsia (n=10); (4) healthy pregnant women as a control group (n=10). The gestational age difference between al...
Embodiment 3
[0085] Example 3: Comparison of mir-210 content in plasma between healthy pregnant women and pregnant women with pregnancy-induced hypertension
[0086] Comparing the has-mir-210 in the plasma of all pregnant women with pregnancy-induced hypertension with the has-mir-210 in the plasma of healthy pregnant women, using the t test, the result P figure 1 )
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap