Unlock instant, AI-driven research and patent intelligence for your innovation.

Hsa-mir-210 kit for detecting pregnancy-hypertension syndrome and detecting method thereof

A technology of hsa-mir-210 and gestational hypertension, applied in the field of medical biological detection, can solve the problem of no has-mir-210 and the like, and achieve the effect of reducing the occurrence of gestational hypertension and its related complications

Inactive Publication Date: 2010-02-10
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no relevant report on using has-mir-210 as a marker for detecting the occurrence and development of PIH

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hsa-mir-210 kit for detecting pregnancy-hypertension syndrome and detecting method thereof
  • Hsa-mir-210 kit for detecting pregnancy-hypertension syndrome and detecting method thereof
  • Hsa-mir-210 kit for detecting pregnancy-hypertension syndrome and detecting method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Preparation of the kit of the present invention (for one person)

[0035] The composition of the kit of the present invention is as follows:

[0036] 1. 1 tube of reverse transcription primer, 100μl / tube concentration: 10μM reverse transcription primer:

[0037] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGCCGCT

[0038] 2. 1 tube each of the upstream and downstream primers of Real-time PCR, 100μl / tube concentration: 10μM;

[0039] The upstream primer is: ACGATGCTGTGCGTGTGAC

[0040] The downstream primer is: GTGCAGGGTCCGAGGT

[0041] 3. Trizol reagent 1 tube 2000μl / tube

[0042] 4.Chloroform 1 tube 500ul / tube

[0043] 5. Anhydrous ethanol 1 tube 7ml / tube

[0044] 6.DEPC H 2 O 1 tube 1000μl / tube

[0045] 7.dd H 2 O 1 tube 2000μl / tube.

[0046] The present invention finds the mature body sequence CUGUGCGUGUGACAGCGGCUGA of hsa-mir-210 according to known bioinformatics. Its specific reverse transcription primers and Real-time PCR upstream and downstream primers are all design...

Embodiment 2

[0058] Example 2: Detection of the kit of the present invention

[0059] 1. Collection of plasma samples and sample preparation:

[0060] Because plasma has the advantages of convenient sampling, non-invasiveness, and continuous detection, the detection of biomarkers for pregnancy-induced hypertension from plasma can improve the detection technology of pregnancy-induced hypertension to a new level, thereby achieving early prevention, The purpose of early treatment.

[0061] Plasma samples were collected in the Department of Obstetrics and Gynecology of Shanghai Changhai Hospital and the Department of Obstetrics and Gynecology of the First Affiliated Hospital of Anhui Medical University, and divided into the following four groups: (1) Pregnant women with hypertension in pregnancy (n=10); (2) Mild aura Pregnant women with epilepsy (n=10); (3) pregnant women with severe preeclampsia (n=10); (4) healthy pregnant women as a control group (n=10). The gestational age difference between al...

Embodiment 3

[0085] Example 3: Comparison of mir-210 content in plasma between healthy pregnant women and pregnant women with pregnancy-induced hypertension

[0086] Comparing the has-mir-210 in the plasma of all pregnant women with pregnancy-induced hypertension with the has-mir-210 in the plasma of healthy pregnant women, using the t test, the result P figure 1 )

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biomedical detection. Pregnancy-hypertension syndrome is one of the critical factors resulting in death for gravida, puerpera, etus and infant. The current detection method is carried out mainly relying on the symptom existing clinically as well as based on some biochemical indicators; in fact, pregnancy-hypertension syndrome exists in early pregnantstage, while early detection landmark is lack in clinical practice for early detection and prevention of the disease. The invention aims at providing a hsa-mir-210 kit for detecting pregnancy-hypertension syndrome and a detection method thereof. By detecting variation of the hsa-mir-210 content in plasma or serum, the invention can more effectively carry out early detection on patients with pregnancy-hypertension syndrome and discover high-risk people with pregnancy-hypertension syndrome so as to prevent the disease effectively in time, and decrease occurrence of pregnancy-hypertension syndrome as well as related complication.

Description

Technical field [0001] The invention relates to the technical field of medical biology detection, and is a kit for detecting the occurrence and development of pregnancy-induced hypertension syndrome by changing the content of hsa-mir-210 in plasma or serum, and a detection method thereof. Background technique [0002] Pregnancy-induced hypertension syndrome (pregnancy-induced hypertension) is a unique disease of pregnancy caused by multiple system disorders, which mostly occurs after 20 weeks of pregnancy. The clinical manifestations are high blood pressure, proteinuria, edema. In severe cases, headache, dizziness, blurred vision and other conscious symptoms may occur. If not treated in time, it may cause systemic convulsions or even coma, as well as functional disorders of the kidneys, liver and brain. And blood coagulation disorders are currently one of the main factors of pregnancy, maternal, fetal, and infant deaths. Among them, eclampsia is still the primary cause of materna...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 孙树汉张毅费明钰贾音
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY