Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus anthracis capable of showing PA20 protein on surface of spore and application thereof

A Bacillus anthracis, surface display technology, applied in the direction of bacteria, antibacterial drugs, bacterial antigen components, etc., can solve the problems of side effects, residual toxicity, etc.

Active Publication Date: 2010-08-11
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The A16R strain currently used in vaccines in my country is an attenuated strain with only a large pXO1 plasmid, but it has some shortcomings such as residual toxicity and side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus anthracis capable of showing PA20 protein on surface of spore and application thereof
  • Bacillus anthracis capable of showing PA20 protein on surface of spore and application thereof
  • Bacillus anthracis capable of showing PA20 protein on surface of spore and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1, a strain can display PA on the surface of spores 20 Obtaining Mutant Strain of Bacillus Anthracis

[0026] 1. Construction of targeting vector

[0027] Extraction of Bacillus anthracis A16R strain (Proteomic analysis of the sterile culture filtrate of Bacillus anthracis A16R strain Dong Mei, Zhuang Hanlan, Wang Xiliang, Journal of the Academy of Military Medical Sciences, February 2009, Volume 33, Issue 1, sponsored by the Academy of Military Medical Sciences of the Chinese People's Liberation Army. The plasmid pXO1 stored in the Institute of Engineering) was used to obtain pagA by PCR reaction using the plasmid pXO1 as a template 20 Gene, primers are PA20F (5'CCAATGCATGAAGTTAAACAGGAGAA3' (sequence 1 in the sequence listing)) and PA20R (5'TCCCCGCGGTTATCGCTTTTTTCT 3' (sequence 2 in the sequence listing)), PCR amplification conditions are 94 ° C pre-denaturation for 5min, and then amplified for 30 A cycle: 94°C for 30s, 60°C for 30s, 72°C for 1min, and finall...

Embodiment 2

[0044] Embodiment 2, the spore protein analysis of Bacillus anthracis (Bacillus anthracis) AP423

[0045] Bacillus anthracis (Bacillus anthracis) AP423 was inoculated in 100mL LB liquid medium, cultured continuously at 37°C for 5 days, and stained to observe the spore formation.

[0046] Take all the culture solution, centrifuge at 17000g for 5 minutes, discard the supernatant, wash once with an equal volume of sterile water, and finally use 100 μL spore protein lysate (0.1M DTT, 0.5% (mass percentage) SDS, 0.1M NaCl, pH 10.0), incubate at 37°C for 2 hours and 30 minutes, centrifuge at 17,000g for 10 minutes, discard the supernatant, and dissolve the precipitate with 100 μL PBS to obtain the recombinant bacterial protein, and use 10% gel for SDS-PAGE electrophoresis analysis.

[0047] On the basis of SDS-PAGE analysis, immunoblot analysis was performed. SDS-PAGE electrophoresis was performed on AP422 (the whole bacterial protein was obtained by the same method as above-mentio...

Embodiment 3

[0050] Embodiment 3, the spore immune effect verification of Bacillus anthracis (Bacillus anthracis) AP423

[0051] Balb / c mice were immunized with AP423 spores, and each mouse was injected with about 10 9 spores were immunized three times in total, and the time interval between the two immunizations was two weeks. Two weeks after the third immunization, the serum was taken for ELISA reaction detection, and the results are shown in Figure 7 , the results showed that the serum titer could reach 1600 times (p Figure 7 Middle ck is Balb / c mice immunized with AP422 spores.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a bacillus anthracis capable of showing a PA20 protein on the surface of a spore and an application thereof. The bacillus anthracis is obtained by inserting a pagA20 gene into the tail end of a bacillus anthracis spore protein bcIA gene; and particularly the bacillus anthracis can be a bacillus anthracis CGMCC No.3403. The bacillus anthracis can serve as a host and is used for preparing, an immunomodulator which is preferably an inactivated vaccine, an attenuated live vaccine, a subunit vaccine or a gene engineering vaccine.

Description

technical field [0001] The present invention relates to a strain capable of displaying PA on the surface of spores 20 Proteins of Bacillus anthracis and their applications. Background technique [0002] The anthrax spore attack after 9 / 11 caused people to panic about biological weapons. The spores formed by Bacillus anthracis have a long survival time, are easy to spread, and cause anthrax bacillosis with fast onset time and high mortality. It is listed as a Class B infectious disease in my country and is one of the weapons of choice for terrorists. [0003] The virulent strain of B. anthracis contains two large plasmids, which are pXO1 plasmid (184.5kbp) encoding toxin base and pXO2 plasmid (95.3kbp) for synthesizing capsule-related genes. Strongly virulent strains require the existence of two kinds of plasmids. If pXO1 is lacking, no toxin will be produced, which means attenuated bacteria; if pXO2 is lacking, capsules will not be formed, which is a hundred times less vir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21A61K39/02A61P31/04A61P37/04C12R1/07
Inventor 展德文王艳春刘纯杰陶好霞袁盛凌王令春王芃
Owner INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More