Bacillus anthracis capable of showing PA20 protein on surface of spore and application thereof
A Bacillus anthracis, surface display technology, applied in the direction of bacteria, antibacterial drugs, bacterial antigen components, etc., can solve the problems of side effects, residual toxicity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1, a strain can display PA on the surface of spores 20 Obtaining Mutant Strain of Bacillus Anthracis
[0026] 1. Construction of targeting vector
[0027] Extraction of Bacillus anthracis A16R strain (Proteomic analysis of the sterile culture filtrate of Bacillus anthracis A16R strain Dong Mei, Zhuang Hanlan, Wang Xiliang, Journal of the Academy of Military Medical Sciences, February 2009, Volume 33, Issue 1, sponsored by the Academy of Military Medical Sciences of the Chinese People's Liberation Army. The plasmid pXO1 stored in the Institute of Engineering) was used to obtain pagA by PCR reaction using the plasmid pXO1 as a template 20 Gene, primers are PA20F (5'CCAATGCATGAAGTTAAACAGGAGAA3' (sequence 1 in the sequence listing)) and PA20R (5'TCCCCGCGGTTATCGCTTTTTTCT 3' (sequence 2 in the sequence listing)), PCR amplification conditions are 94 ° C pre-denaturation for 5min, and then amplified for 30 A cycle: 94°C for 30s, 60°C for 30s, 72°C for 1min, and finall...
Embodiment 2
[0044] Embodiment 2, the spore protein analysis of Bacillus anthracis (Bacillus anthracis) AP423
[0045] Bacillus anthracis (Bacillus anthracis) AP423 was inoculated in 100mL LB liquid medium, cultured continuously at 37°C for 5 days, and stained to observe the spore formation.
[0046] Take all the culture solution, centrifuge at 17000g for 5 minutes, discard the supernatant, wash once with an equal volume of sterile water, and finally use 100 μL spore protein lysate (0.1M DTT, 0.5% (mass percentage) SDS, 0.1M NaCl, pH 10.0), incubate at 37°C for 2 hours and 30 minutes, centrifuge at 17,000g for 10 minutes, discard the supernatant, and dissolve the precipitate with 100 μL PBS to obtain the recombinant bacterial protein, and use 10% gel for SDS-PAGE electrophoresis analysis.
[0047] On the basis of SDS-PAGE analysis, immunoblot analysis was performed. SDS-PAGE electrophoresis was performed on AP422 (the whole bacterial protein was obtained by the same method as above-mentio...
Embodiment 3
[0050] Embodiment 3, the spore immune effect verification of Bacillus anthracis (Bacillus anthracis) AP423
[0051] Balb / c mice were immunized with AP423 spores, and each mouse was injected with about 10 9 spores were immunized three times in total, and the time interval between the two immunizations was two weeks. Two weeks after the third immunization, the serum was taken for ELISA reaction detection, and the results are shown in Figure 7 , the results showed that the serum titer could reach 1600 times (p Figure 7 Middle ck is Balb / c mice immunized with AP422 spores.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com