Genetic modification method for high-yield glutathione strain

A technology of glutathione and genetic transformation, applied in the direction of microorganism-based methods, biochemical equipment and methods, and the use of vectors to introduce foreign genetic materials, etc., can solve the problems that GSH cannot meet market demand and the GSH market has a large gap, and achieve Low cost, simple fermentation method, and the effect of reducing production costs

Inactive Publication Date: 2010-09-08
HANGZHOU KANGYUAN FEED TECH
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] But, because the market vacancy of GSH is bigger, the GSH that applies above-mentioned method to produce can't meet market demand far away.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] The concrete steps of the genetic transformation method of a kind of glutathione high-yield strain of the present invention are as follows:

[0021] Step 1: Amplify the target genes GSH1 and GSH2 from the S. cerevisiae INVSc1 genome template, and then load them into pGAPZA respectively to obtain recombinant plasmids pGAPZA-GSH1 and pGAPZA-GSH2:

[0022] 1. Amplify the target gene: GSH1

[0023] Template: S.cerevisiae INVSc1

[0024] Primers:

[0025] GSH1 upstream primer gsh1-1: GAAGCTCGAGACCATGGGACTCTTAGCTTTGGGCACGCC (added Kozak sequence) (XhoI)

[0026] GSH1 downstream primer gsh1-2: TCCTCGGGGCCCAATGGTCACGGCGTCTGGCTACG(ApaI)

[0027] PCR amplification reaction: DNA template 1 μl, 10×PCR buffer 2 μl, primer 2 μl, dNTP 5 μl, Taq DNA polymerase 0.5 μl, the total reaction volume is 20 μl, denaturation at 94°C for 5 minutes, 94°C for 45s, 58°C for 90s, 72°C 120s, 35 cycles. Amplified products were detected by 1.2% agarose gel electrophoresis. Fragment size: 2405bp. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetic modification method for a high-yield glutathione strain, which adopts Pichiapastoris as an improved object. The genetic modification method for the high-yield glutathione strain comprises four steps. The Pichiapastoris per se has good safety. A yeast culture medium does not contain toxic substances and pyrogens. The genetic modification method for the high-yield glutathione strain has the advantages of simpleness and convenience, readily available fermentation raw materials, energy saving, high yield and low cost. A promoter selected by the method does not need to be induced by methanol. The fermentation process is simple and the yield is high. The method reduces the use of the precursor in the strain genetic modification process so as to reduce the production cost.

Description

technical field [0001] The invention relates to a method for genetic modification of strains, in particular to a method for genetic modification of high-yield glutathione strains applied in the fields of medicine, food and feed. Background technique [0002] At present, the production methods of glutathione (GSH) mainly include extraction method, chemical synthesis method, immobilized cell method and fermentation method, wherein the immobilized cell method is also called enzymatic method. [0003] GSH is produced by extraction method, which uses plant seed germ or yeast as raw material, water, organic solution or dilute alcohol as solvent to extract GSH, the purity and yield of GSH produced by extraction method are not high, if it is used in medicine or reagent The GSH produced by the extraction method needs to be further purified by combining ion exchange and other chromatographic separation steps in the extraction method. The production process is backward, the production ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12R1/84
Inventor潘宏涛
OwnerHANGZHOU KANGYUAN FEED TECH