Porcine ROSA26 promoter and application thereof
A promoter, DNA sequence technology, applied in the direction of DNA/RNA fragment, recombinant DNA technology, etc., can solve the problems of exogenous gene silencing, unfavorable efficient and extensive expression of exogenous genes, etc., and achieve the effect of high-efficiency and stable expression.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Porcine ROSA26 promoter
[0025] The ROSA26 promoter is shown in SEQ ID NO.1, or a DNA sequence that can hybridize with the DNA sequence defined in SEQ ID NO.1 under stringent conditions (Tm-10~15°C) and can promote the transcription and translation of the target gene, or A DNA sequence that has more than 90% homology with the DNA sequence defined by SEQ ID NO.1 and can promote the transcription and translation of the target gene.
Embodiment 2
[0026] Cloning of embodiment 2 pig ROSA26 promoter
[0027] According to the principle of complementary base pairing, the upstream and downstream primers for cloning the full-length sequence were designed on both sides of the 5' and 3' sides of the sequence SEQ ID NO. It is used for carrier construction, and finally various parameters such as Tm value and GC content are verified by Oligo 6.0 software. The primer sequences were: 5'GCATTAATCTCGAGTTAGGCCCAACGCGGC3' (upstream) and 5'CGGCTAGCCCGCGGCCGCCCATCCC3' (downstream). The PCR reaction system is (20ul):
[0028] Reagent Volume
[0029] rTaq 0.1 μl
[0030] dNTP 2.5ul
[0031] Buffer(10X) 2ul
[0032] Upstream primer (5μM) 1μl
[0033] Downstream primer (5μM) 1μl
[0034] DNA template 0.4μl
[0035] Distilled water 13μl
[0036] The PCR reaction conditions were: 94°C for 3min; 94°C for 30sec, 60°C for 30sec, 72°C for 1min (30cycles); 72°C for 10min; 4°C for 1h.
[0037] Blast alignment results of the porcine ROSA26 p...
Embodiment 3
[0038] Example 3 Expression of the first exon of ROSA26 gene in various tissues of pigs
[0039]According to the DNA sequence of the first exon, the Primer Premier 5.0 software was used to design, and the parameters were verified by the Oligo 6.0 software, and the primer pairs were screened. The primer sequences were: 5'CGCCTAGAGAAGAGGCTGTGCTCTG3' (upstream) and 5'CAGAGTCCCGCTCCCCTACCTAGC3' (downstream).
[0040] The Q-PCR reaction system is (20ul):
[0041] Reagent volume
[0042] SYBR Premix Ex Taq (2X) 10μl
[0043] Upstream primer (5μM) 1μl
[0044] Downstream primer (5μM) 1μl
[0045] cDNA template 0.2μl
[0046] Distilled water 7.8μl
[0047] The Q-PCR reaction conditions were: 95°C for 10 sec; 95°C for 5 sec, 60°C for 31 sec (40 cycles); 95°C for 15 sec, 60°C for 30 sec, and 95°C for 15 sec.
[0048] The expression of the first exon in various tissues of pigs was detected by Q-PCR. The test results show that pROSA26 can mediate the widespread expression of the f...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com