Transformant for blocking effect of porcine somatostatin by oral immunization and application thereof
A technology of somatostatin and transformants, applied in the field of bioengineering, can solve the problems of difficulty in realization of protein preparations, cost and labor, and achieve the effects of enhancing the immune response of the body, improving the immune effect and increasing the safety.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0022] GM17 liquid medium: tryptone 2%; yeast extract 0.5%; Vc 0.05%; beef extract 0.5%; sodium acetate 0.15%; sodium chloride 0.4%; MgSO 4 .7H 2 O 0.25%; Glucose 0.5%, adjusted to pH 6.8. GM17 solid medium was supplemented with 1.6% agar on the basis of the above medium.
[0023] Lactococcus lactis NZ9800 and vector pNZ8112 are both commercial products from NIZO food research in the Netherlands.
[0024] 1. Construction and cloning of the target gene
[0025] (1) Construction of CTB-SST chimeric gene
[0026] Upstream primer (SEQ ID NO.1):
[0027] 5'-GG ACACCTCAAAATATTACTG -3'
[0028] The primer structure is: protected base (GG)-Xba I site (sequence in the box)-CTB 5' end partial sequence (underlined sequence)
[0029] Downstream primer (SEQ ID NO.2):
[0030] 5'-TG ACACGAAGTGAAAGTCTTCCAAAAGAAGTTCTT ACAACCAGC GGGGCCGGGGCC
[0031] Primer structure: protected base (TG)-BamH I site (sequence in box)-SST sequence (underline)-linker (bold italic sequence)-CT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
