Transformant for blocking effect of porcine somatostatin by oral immunization and application thereof

A technology of somatostatin and transformants, applied in the field of bioengineering, can solve the problems of difficulty in realization of protein preparations, cost and labor, and achieve the effects of enhancing the immune response of the body, improving the immune effect and increasing the safety.

Inactive Publication Date: 2010-11-24
ZHEJIANG UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Protein purification steps greatly increase the cost and difficulty of production, making it difficult to achieve large-scale production of target protein preparations
At the same time, the injection immunization procedure is also cumbersome, which not only consumes a lot of manpower, but also causes greater stress and damage to animals.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transformant for blocking effect of porcine somatostatin by oral immunization and application thereof
  • Transformant for blocking effect of porcine somatostatin by oral immunization and application thereof
  • Transformant for blocking effect of porcine somatostatin by oral immunization and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] GM17 liquid medium: tryptone 2%; yeast extract 0.5%; Vc 0.05%; beef extract 0.5%; sodium acetate 0.15%; sodium chloride 0.4%; MgSO 4 .7H 2 O 0.25%; Glucose 0.5%, adjusted to pH 6.8. GM17 solid medium was supplemented with 1.6% agar on the basis of the above medium.

[0023] Lactococcus lactis NZ9800 and vector pNZ8112 are both commercial products from NIZO food research in the Netherlands.

[0024] 1. Construction and cloning of the target gene

[0025] (1) Construction of CTB-SST chimeric gene

[0026] Upstream primer (SEQ ID NO.1):

[0027] 5'-GG ACACCTCAAAATATTACTG -3'

[0028] The primer structure is: protected base (GG)-Xba I site (sequence in the box)-CTB 5' end partial sequence (underlined sequence)

[0029] Downstream primer (SEQ ID NO.2):

[0030] 5'-TG ACACGAAGTGAAAGTCTTCCAAAAGAAGTTCTT ACAACCAGC GGGGCCGGGGCC

[0031] Primer structure: protected base (TG)-BamH I site (sequence in box)-SST sequence (underline)-linker (bold italic sequence)-CT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses transformant. The transformant comprises a recipient bacterium and a recombinant vector transferred to the recipient bacterium, wherein the recipient bacterium is lactococcus lactis NZ9800; the original vector of the recombinant vector is pNZ8112; and the exogenous target gene of the recombinant vector comprises a porcine somatostatin gene, a cholera toxin B subunit gene and a cell wall anchor stator M6 gene. The transformant can enter the porcine intestinal tract by oral administration; compared with injection immunization, the oral immunization mode reduces the toxicity caused by direct contact with a circulatory system and increases the safety of vaccines; and the immune response of organisms is enhanced and the immune effect is improved by combined immunization of the transformant, an antigen gene and an immune enhancing factor.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to a transformant capable of orally immunizing and blocking porcine somatostatin and its application. Background technique [0002] Compared with foreign breeds, local pig breeds in my country have the characteristics of high adaptability to the surrounding environment, tolerance to extensive management, strong disease resistance, high fecundity, and good meat quality. However, due to the slow growth of local pig breeds in my country and the low feed utilization rate, along with the introduction of a large number of foreign high-performance breeds, the cruel market competition has caused the number of local pig breeds in my country to decline sharply, and some breeds are even endangered or tend to become extinct, such as The number of Jinhua pigs, famous for their cured Jinhua ham, has been greatly reduced. Although foreign pig breeds grow fast and have high feed utilization rate, the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21A61K39/00A61K35/74A61P43/00C12R1/01A61K35/744
Inventor 牛冬
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap