Application of saussurea involucrata sikRbcS2 gene for culturing cold resistant plant
A gene, snow lotus technology, applied in the application field of Tianshan snow lotus sikRbcS2 gene in the cultivation of cold-resistant plants, can solve the problems of reduced sensitivity and increased activity, and achieve the goal of improving low temperature resistance and enriching the molecular biology theory of plant cold resistance Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1: Extraction of Monoclonal Plasmids from the Tianshan Saussurea cDNA Library
[0047] Take the glycerol tube in which the monoclonal preservation of the Saussurea tianshanensis cDNA library was preserved, and place it in 10 ml of LB liquid medium (Cm 50 μg / ml), and culture it overnight at 37°C and 220 rpm with shaking. Dip the bacterial solution and streak culture on LB solid medium (Cm 50 μg / ml) plate, and cultivate in dark at 37°C for 12-16hr. Pick a single clone in 20ml LB liquid medium (Cm 50μg / ml), shake and culture at 220rpm at 37°C for 14hr, and extract the plasmid. The specific method is as follows:
[0048] 1) Divide the bacterial solution into 1.5ml Ep tubes, centrifuge at 12000rpm for 3min, and discard the supernatant;
[0049] 2) Add 400ml of STE solution, resuspend, centrifuge at 12000rpm for 3min, and discard the supernatant;
[0050] 3) Resuspend the precipitate with 150 μL of alkaline lysis solution I, and mix well;
[0051] 4) Add freshly pr...
Embodiment 2
[0056] Example 2: Cloning the sikRbcS2 gene from Saussurea tianshanensis
[0057] Using the monoclonal plasmid of the Saussurea sauraceae cDNA library as a template, use RP1 whose sequence is 2 and RP2 whose sequence is 3 as primers to amplify to obtain the target gene; at the same time, use deionized water as a template to amplify as a negative control.
[0058] RP1 is: 2
[0059] 5′ttatcagtcgaaggtacgg 3′
[0060] RP2 is: 3
[0061] 5′ gctttctagaccattcgttggcgcg 3′
[0062] The PCR reaction system (20μl) is:
[0063] 10×PCR Buffer 2.0μ1
[0064] dNTPs (2.5mM each) 0.5μl
[0065] MgCl2 (25mM) 1.0μl
[0066] Upstream primer (25μM) 0.5μl
[0067] Downstream primer (25μM) 0.5μl
[0068] Template DNA (ddH 2 O) 0.5 μl
[0069] Taq DNA Polymerase (2.5U / μl) 0.3ul
[0070] wxya 2 O 14.7 μl
[0071] Total 20.0μl
[0072] The PCR reaction program was: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, refolding at 68°C for 120 s, 30 cycles; extension at 72°...
Embodiment 3
[0074] Embodiment 3: Construction sikRbcS2 gene plant expression vector
[0075] Construction of plant expression vectors: pCAMBIA1301-sikRbcS2 and pCAMBIA2301-sikRbcS2. The E.coli DH5α of pCAMBIA1301 and pCAMBIA2301 were double digested with Nco I / BstE II respectively to obtain vector fragments. Recover target gene fragments and vector fragments. The target gene fragment was ligated with the vector fragment in vitro, and the identified correct recombinant plasmids were named pCAMBIA1301-sikRbcS2 and pCAMBIA2301-sikRbcS2 respectively. In this embodiment, we choose tobacco as the transgenic plant material, and other plants can also be used as the transgenic material.
[0076] In this embodiment, the sikRbcS2 gene and pCAMBIA2301 constitute a plant expression vector for plant transformation. According to this embodiment of the present invention, in addition to pCAMBIA2301, other plant expression vectors can also be selected for construction of the selected plant expression ve...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More