Enhanced CpGV virus preparation and preparation method thereof
An enhanced, virus technology, applied in the fields of botanical equipment and methods, pesticides, biocides, etc., can solve the problems of virus inactivation, apple production loss, and high cost of virus preparations for pest control, and achieve high virulence and lethality. The effect of short time and improved biological control effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
preparation example Construction
[0034] The preparation method of the enhanced CpGV virus preparation of the present invention is specifically implemented according to the following steps:
[0035] Step 1: Preparation of active protein M2R solution
[0036] (1) Source of toxin protein gene and construction of genetically engineered strains expressing toxin protein:
[0037] The CryIAB gene was cloned from the isolated Bacillus thuringiensis, and after gene cloning and sequencing, the expression vector PET-28a-CryIAB was constructed. The expression vector was electroporated to transform E.coliBL21, and the engineering strain E.coli BL21-28a-CryIAB containing the CryIAB toxin protein gene was obtained.
[0038] The sequence of the CryIAB gene is:
[0039] ATGGATAACAATCCGAACATCAATGAATGCATTCCTTAATTGTTTAAG
[0040] TAACCCTGAAGTAGAAGTATTAGGTGGAGAAAGAATAGAAACTGGTTA
[0041] CACCCCAATCGATATTTCCTTGTCGCTAACGCAATTTCTTTTGAGTGAAT
[0042] TTGTTCCCGGTGCTGGATTTGTGTTAGGACTAGTTGATATAATATGGGGA
[0043]ATTTTTGGTCCCTCTCAAT...
Embodiment 1
[0123] Step 1: Preparation of active protein M2R solution
[0124] (1) Induced expression of toxin protein:
[0125] Pick a single colony of the engineering strain E.coli BL21-28a-CryIAB, inoculate it in 10ml liquid LB medium containing 100ug / ml ampicillin, and cultivate overnight at 37°C with shaking at 200r / min. Inoculate at 1% (V / V) in 1L liquid LB medium containing 100ug / ml ampicillin, culture at 37°C and 260r / min until the OD600 of the bacterial solution is 0.3-0.5, then add an appropriate concentration of IPTG (final concentration 10uM) , to induce expression, 25-35°C, 200-320rpm, induction 4-8hr.
[0126] (2) Collection of expressed proteins:
[0127] 1L of expressing bacteria was collected by centrifugation at 6000rpm for 5min, resuspended in 100ml of PBS buffer, and washed to remove medium components; repeat the above process 1-2 times. Collect the cells by centrifugation, suspend the cells in 10ml of PBS buffer, and disrupt the cells by ultrasonic (intensity 10-20...
Embodiment 2
[0133] Step 1: Preparation of active protein M2R solution
[0134] (1) Induced expression of toxin protein:
[0135] Pick a single colony of the engineering strain E.coli BL21-28a-CryIAB, inoculate it in 10ml liquid LB medium containing 100ug / ml ampicillin, and cultivate overnight at 37°C with shaking at 200r / min. Inoculate at 1% (V / V) in 1L liquid LB medium containing 100ug / ml ampicillin, culture at 37°C and 260r / min until the OD600 of the bacterial solution is 0.3-0.5, then add an appropriate concentration of IPTG (final concentration 10uM) , to induce expression, 25-35°C, 200-320rpm, induction 4-8hr.
[0136] (2) Collection of expressed proteins:
[0137] 1L of expressing bacteria was collected by centrifugation at 6000rpm for 5min, resuspended in 100ml of PBS buffer, and washed to remove medium components; repeat the above process 1-2 times. Collect the cells by centrifugation, suspend the cells in 10ml of PBS buffer, and disrupt the cells by ultrasonic (intensity 10-20...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More