Unlock instant, AI-driven research and patent intelligence for your innovation.

Enhanced CpGV virus preparation and preparation method thereof

An enhanced, virus technology, applied in the fields of botanical equipment and methods, pesticides, biocides, etc., can solve the problems of virus inactivation, apple production loss, and high cost of virus preparations for pest control, and achieve high virulence and lethality. The effect of short time and improved biological control effect

Inactive Publication Date: 2013-07-17
NORTHWEST A & F UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Wuwei epidemic area in Gansu Province is less than 300 kilometers away from Shaanxi Province, one of our main apple producing areas. If the codling moth is introduced into Shaanxi, it is very easy because there is no extreme geographical isolation zone between Shaanxi and Shandong provinces. Then it quickly spread to the main production area of ​​Shandong, which will definitely cause a devastating loss to our apple production
[0003] Codling moth granular virus (CpGV) is one of the main means to control codling moth in Europe, but the control of codling moth in China still mainly relies on chemical pesticides. One of the reasons is that codling moth is a quarantine object in There is no distribution in the main production areas of apples, and it is currently limited to economically underdeveloped areas such as Xinjiang and Gansu. The cost of using virus agents to control pests is high; and the more important reason is that codling moths are mainly distributed in Xinjiang, Gansu and other arid areas. 1. In areas with strong sunlight, insect viruses are used for field control. Viruses are easily inactivated in strong sunlight and high temperature environments, while codling moths are insect species with very serious generation overlap. There are 3-4 generations every year, and long-term and continuous application is required. In order to achieve the control effect, the use of simple virus preparations for prevention and control has a low virus infection rate, a large amount of virus, and high costs; and if chemical pesticides are used in combination, it will not be possible to realize the proliferation of the virus in the pest after the pest is infected with the virus. Killed by pesticides, leading to the loss of the effect of using viruses for biological control, especially the inability to produce the post-effect of persistent epidemics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0034] The preparation method of the enhanced CpGV virus preparation of the present invention is specifically implemented according to the following steps:

[0035] Step 1: Preparation of active protein M2R solution

[0036] (1) Source of toxin protein gene and construction of genetically engineered strains expressing toxin protein:

[0037] The CryIAB gene was cloned from the isolated Bacillus thuringiensis, and after gene cloning and sequencing, the expression vector PET-28a-CryIAB was constructed. The expression vector was electroporated to transform E.coliBL21, and the engineering strain E.coli BL21-28a-CryIAB containing the CryIAB toxin protein gene was obtained.

[0038] The sequence of the CryIAB gene is:

[0039] ATGGATAACAATCCGAACATCAATGAATGCATTCCTTAATTGTTTAAG

[0040] TAACCCTGAAGTAGAAGTATTAGGTGGAGAAAGAATAGAAACTGGTTA

[0041] CACCCCAATCGATATTTCCTTGTCGCTAACGCAATTTCTTTTGAGTGAAT

[0042] TTGTTCCCGGTGCTGGATTTGTGTTAGGACTAGTTGATATAATATGGGGA

[0043]ATTTTTGGTCCCTCTCAAT...

Embodiment 1

[0123] Step 1: Preparation of active protein M2R solution

[0124] (1) Induced expression of toxin protein:

[0125] Pick a single colony of the engineering strain E.coli BL21-28a-CryIAB, inoculate it in 10ml liquid LB medium containing 100ug / ml ampicillin, and cultivate overnight at 37°C with shaking at 200r / min. Inoculate at 1% (V / V) in 1L liquid LB medium containing 100ug / ml ampicillin, culture at 37°C and 260r / min until the OD600 of the bacterial solution is 0.3-0.5, then add an appropriate concentration of IPTG (final concentration 10uM) , to induce expression, 25-35°C, 200-320rpm, induction 4-8hr.

[0126] (2) Collection of expressed proteins:

[0127] 1L of expressing bacteria was collected by centrifugation at 6000rpm for 5min, resuspended in 100ml of PBS buffer, and washed to remove medium components; repeat the above process 1-2 times. Collect the cells by centrifugation, suspend the cells in 10ml of PBS buffer, and disrupt the cells by ultrasonic (intensity 10-20...

Embodiment 2

[0133] Step 1: Preparation of active protein M2R solution

[0134] (1) Induced expression of toxin protein:

[0135] Pick a single colony of the engineering strain E.coli BL21-28a-CryIAB, inoculate it in 10ml liquid LB medium containing 100ug / ml ampicillin, and cultivate overnight at 37°C with shaking at 200r / min. Inoculate at 1% (V / V) in 1L liquid LB medium containing 100ug / ml ampicillin, culture at 37°C and 260r / min until the OD600 of the bacterial solution is 0.3-0.5, then add an appropriate concentration of IPTG (final concentration 10uM) , to induce expression, 25-35°C, 200-320rpm, induction 4-8hr.

[0136] (2) Collection of expressed proteins:

[0137] 1L of expressing bacteria was collected by centrifugation at 6000rpm for 5min, resuspended in 100ml of PBS buffer, and washed to remove medium components; repeat the above process 1-2 times. Collect the cells by centrifugation, suspend the cells in 10ml of PBS buffer, and disrupt the cells by ultrasonic (intensity 10-20...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an enhanced CpGV virus preparation, which is prepared from the following components by volume percent: 6-30% of activated protein M2R solution, 0.5-1.5% of CpGV suspension, 1-3% of Tween-80 emulsifier and the balance of 1*PBS buffer solution, wherein the sum of volume percent of the components is 100%. The preparation method for the enhanced CpGV virus preparation comprises the following steps: building expressed toxin protein gene engineering strain; inducing expressed toxin protein; collecting the expressed toxin protein; preparing an activity protein M2R solution; and mixing the components to obtain the enhanced CpGV virus preparation of the invention. The preparation method of the enhanced CpGV virus preparation has simple preparation process; and the prepared virus preparation has the advantages of high toxicity and short lethal time, and can obviously improve the control efficiency of the CpGV virus to carpocapsa pomonella.

Description

technical field [0001] The invention belongs to the technical field of pest biological control, and in particular relates to an enhanced CpGV virus preparation, and also relates to a preparation method of the preparation. Background technique [0002] Since the codling moth invaded my country in the middle of the last century, it has seriously occurred in most areas of Xinjiang and Jiuquan, Zhangye, Jiayuguan, Jinchang, Wuwei and other areas in Gansu, and is rapidly moving to Shaanxi and other places, which are the dominant apple producing areas in my country, along the Hexi Corridor. Pushing forward, the situation is very grim. The Wuwei epidemic area in Gansu Province is less than 300 kilometers away from Shaanxi Province, one of our main apple producing areas. If the codling moth is introduced into Shaanxi, it is very easy because there is no extreme geographical isolation zone between Shaanxi and Shandong provinces. Then it quickly spread to the main production area of ​...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01N63/02A01N63/00A01P7/04
Inventor 王敦张雅林李坚王玉芹徐红星郑春寒董琨徐利
Owner NORTHWEST A & F UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More