Swine promoter protein expression vector and construction method and application thereof
A protein expression and promoter technology, applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of cumbersome steps, low connection efficiency, high cost, etc., and achieve the effect of improved level, simple process and ideal efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1, the construction of pSP-Vector
[0031] 1) Construction of pS1
[0032] Design primers pS1 Vector1 upstream and pS1 Vector1 downstream, pS1 Vector2 upstream and pS1 Vector2 downstream, the sequences of primers pS1 Vector1 upstream and pS1 Vector1 downstream, pS1 Vector2 upstream and pS1 Vector2 downstream are as follows:
[0033] Upstream of pS1 Vector1: 5′ ACATGTTCTTTCCTGCGCCGCTACAGGG 3′;
[0034] Downstream of pS1 Vector1: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3'.
[0035] Upstream of pS1 Vector2: 5′CTCGAGGATATCTGCA GATATC CAGCACAC 3′ (the underlined part is
[0036] EcoR V enzyme recognition site);
[0037] Downstream of pS1 Vector2: 5'CCCTGTAGCGGCGCAGGAAAGAACATGT 3'.
[0038] Using the pEGFP-N1 (purchased from Invitrogen) plasmid as a template, use primers pS1 Vector1 upstream and pS1 Vector1 downstream PCR amplification fragment A, use pCDNA3.0 plasmid (purchased from Invitrogen) as a template, use primers pS1 Vector2 upstream and pS1 Vector2 Dow...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap