Check patentability & draft patents in minutes with Patsnap Eureka AI!

Swine promoter protein expression vector and construction method and application thereof

A protein expression and promoter technology, applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of cumbersome steps, low connection efficiency, high cost, etc., and achieve the effect of improved level, simple process and ideal efficiency

Inactive Publication Date: 2013-03-20
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional enzymatic digestion connection method has problems such as cumbersome steps, high cost, and low connection efficiency. The PCR product and the carrier must go through repeated enzyme digestion, electrophoresis, recovery and other steps before further connection can be carried out.
This is time-consuming, and the efficiency of the connection is not ideal, which needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Swine promoter protein expression vector and construction method and application thereof
  • Swine promoter protein expression vector and construction method and application thereof
  • Swine promoter protein expression vector and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1, the construction of pSP-Vector

[0031] 1) Construction of pS1

[0032] Design primers pS1 Vector1 upstream and pS1 Vector1 downstream, pS1 Vector2 upstream and pS1 Vector2 downstream, the sequences of primers pS1 Vector1 upstream and pS1 Vector1 downstream, pS1 Vector2 upstream and pS1 Vector2 downstream are as follows:

[0033] Upstream of pS1 Vector1: 5′ ACATGTTCTTTCCTGCGCCGCTACAGGG 3′;

[0034] Downstream of pS1 Vector1: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3'.

[0035] Upstream of pS1 Vector2: 5′CTCGAGGATATCTGCA GATATC CAGCACAC 3′ (the underlined part is

[0036] EcoR V enzyme recognition site);

[0037] Downstream of pS1 Vector2: 5'CCCTGTAGCGGCGCAGGAAAGAACATGT 3'.

[0038] Using the pEGFP-N1 (purchased from Invitrogen) plasmid as a template, use primers pS1 Vector1 upstream and pS1 Vector1 downstream PCR amplification fragment A, use pCDNA3.0 plasmid (purchased from Invitrogen) as a template, use primers pS1 Vector2 upstream and pS1 Vector2 Dow...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a swine promoter protein expression vector and a construction method and application thereof. The expression vector is annular and comprises a pronucleus replication origin, an eukaryon replication origin, a selection marker gene and an exogenous gene expression cassette, wherein the exogenous gene expression cassette consists of a transcription promoter, a junction fragment and a polyadenylic acid tailing signal sequentially from upstream to downstream; and the transcription promoter is an MLP6 promoter. The expression vector can efficiently express exogenous proteins in a swine cell, contains the eukaryon replication origin and can be proliferated greatly in a cell of an expression T antigen, so that protein expression level is raised. A recombinant vector of an expression exogenous gene is constructed by homologous recombination, so that the conventional steps such as enzyme cutting, linking and the like are avoided and 2 to 3 steps are saved compared with the conventional linking process. A vector recombination process for constructing the expression exogenous gene by using the vector of the invention is simple, convenient, rapid, economical and efficient and the construction of the expression vectors of a large number of exogenous genes can be finished rapidly.

Description

technical field [0001] The present invention relates to a eukaryotic expression vector, in particular to a porcine-derived promoter protein expression vector and its construction method. The present invention also relates to the application of the porcine-derived promoter protein expression vector in expressing foreign proteins in porcine cells, belonging to The field of construction of eukaryotic expression vectors. Background technique [0002] my country is a big country in the pig industry, and the development of the pig industry has also promoted research in the fields of pig production, disease prevention and control, especially disease-resistant breeding has gradually been put on the agenda. Due to the lack of protein expression vectors with pig-derived promoters, it is difficult to efficiently express other foreign genes in pigs or in cells. [0003] Eukaryotic expression vectors are one of the most commonly used expression vectors in molecular biology research. In...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/66
Inventor 崔尚金刘芹防刘珊珊张超范
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More