Joint connection-based deoxyribonucleic acid (DNA) polymerase chain reaction (PCR)-free tag library construction method
A technology of linker connection and construction method, which is applied in the direction of DNA/RNA fragmentation, DNA preparation, recombinant DNA technology, etc., can solve the problems of low PCR amplification efficiency, small number of tags, and high cost, and achieve increased sequencing throughput, The effect of reducing the cost of sequencing and improving the recognition rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0868] Example 1: DNA labeling experiment library construction method specific
[0869] 1.1 DNA template preparation
[0870] Using the plasmid pMD18-T (Japanese takara) as a template, use Primer Premier5.0 software to design primers, PCR amplified fragments with a length of 250bp, use the NanoDrop 1000 instrument (U.S. NanoDrop) to detect the concentration of the amplified product, and then take according to the concentration. 1ug of this PCR product was used as an insert for library construction, and water was added to make the volume to 35 μL. PCR primer sequences:
[0871] pMD18-T primer 1: CGGGGAGAGGCGGTTTGCGTATTGG;
[0872] pMD18-T Primer 2: TTTTGTGATGCTCGTCAGGGGGGCG.
[0873] 1.2 End repair [6]
[0874] Prepare the reaction mix in the following proportions:
[0875] pMD18-T plasmid DNA template 35μL
[0876] T4 DNA Ligase Buffer 50 μL
[0877] dNTPs mixture 4 μL
[0878] T4 DNA polymerase 5 μL
[0879] Klenow DNA polymerase 1 μL
[0880] T4 polynucleotide kina...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
