Taq DNA polymerase, and PCR (polymerase chain reaction) fluid and application thereof
A polymerase and reaction solution technology, applied in the biological field, to achieve high yield, avoid cross-contamination, and reliable results of detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] A mutant library of Taq DNA polymerase was constructed and positive mutants were screened. The specific process is as follows:
[0042] (1) Construction of Taq DNA polymerase mutant library.
[0043] The inventor first constructed the mutant library-1 of Taq DNA polymerase by error-prone PCR technology, and obtained 5062 clones, and screened the crudely extracted mutant enzymes of all clones by direct blood PCR experiment, and finally obtained a blood The mutant with the best template amplification effect was named TaqR-1. After sequencing, it was found that compared with the wild-type Taq DNA polymerase, TaqR-1 had mutations at three amino acid positions at the amino acid level, and the mutations were: E641K, Q698E and E708Q.
[0044] Early studies have shown that the 706-708 site of Taq DNA polymerase is the key site affecting its activity. However, the 708 site happens to be included in the three mutation sites of TaqR-1, which is consistent with the previous rela...
Embodiment 2
[0056] Optimization of TianRTaq response buffer. Utilize TianRTaq in the present invention to detect the effect of the PCR reaction solution before and after adjustment on the direct amplification of blood, and the specific operation steps are as follows:
[0057] (1), respectively prepare two groups (4 PCR reactions to be tested) in 200 microliter centrifuge tubes, a total of 8 PCR reaction systems, the added components of the PCR system of each reaction to be tested include: 1 microliter Plasmid DNA template, 0-4 μl of human EDTA-2K anticoagulated blood sample, 1 μl of upstream primer (Pls-F: CCATAGCTGGCATAATGCCTGAC) at a concentration of 5 μmol / L, 1 μl of a concentration of 5 μmol / L The downstream primer (Pls-R: TCGAGTATCTGCAGGCTGTGTCATT), 10 microliters of PCR reaction solution and 0.4 microliters of DNA polymerase, and finally make up the PCR reaction system to 20 microliters with deionized water.
[0058] The plasmid DNA template described therein is pLB plasmid, and th...
Embodiment 3
[0068] The method of the invention detects the resistance of commonly used blood anticoagulants. Detect the inventive method to dipotassium ethylenediaminetetraacetic acid (EDTA-2K), the direct amplification effect of sodium heparin and sodium citrate anticoagulant blood, concrete operating steps are as follows:
[0069] (1), in the centrifuge tube of 200 microliters, prepare respectively three groups (each group 8 PCR reactions to be tested) altogether 24 PCR reaction systems to be tested and a negative control PCR reaction system, the PCR system of each sample to be tested The added components include: 2 μl of human anticoagulated blood sample, 1 μl of upstream primer (Prp-F: GCAGAGCAGTCATTATGGCGAAC) with a concentration of 5 μmol / L, and 1 μl of downstream primer with a concentration of 5 μmol / L (Prp-R: CCCACTATCAGGAAGATGAGGAAA) and 10 microliters of PCR reaction solution, and finally make up the PCR reaction system to 20 microliters with deionized water. The PCR system of ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
