Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Taq DNA polymerase, and PCR (polymerase chain reaction) fluid and application thereof

A polymerase and reaction solution technology, applied in the biological field, to achieve high yield, avoid cross-contamination, and reliable results of detection

Active Publication Date: 2016-08-31
TIANGEN BIOTECH BEIJING
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, existing PCR techniques still need to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Taq DNA polymerase, and PCR (polymerase chain reaction) fluid and application thereof
  • Taq DNA polymerase, and PCR (polymerase chain reaction) fluid and application thereof
  • Taq DNA polymerase, and PCR (polymerase chain reaction) fluid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A mutant library of Taq DNA polymerase was constructed and positive mutants were screened. The specific process is as follows:

[0042] (1) Construction of Taq DNA polymerase mutant library.

[0043] The inventor first constructed the mutant library-1 of Taq DNA polymerase by error-prone PCR technology, and obtained 5062 clones, and screened the crudely extracted mutant enzymes of all clones by direct blood PCR experiment, and finally obtained a blood The mutant with the best template amplification effect was named TaqR-1. After sequencing, it was found that compared with the wild-type Taq DNA polymerase, TaqR-1 had mutations at three amino acid positions at the amino acid level, and the mutations were: E641K, Q698E and E708Q.

[0044] Early studies have shown that the 706-708 site of Taq DNA polymerase is the key site affecting its activity. However, the 708 site happens to be included in the three mutation sites of TaqR-1, which is consistent with the previous rela...

Embodiment 2

[0056] Optimization of TianRTaq response buffer. Utilize TianRTaq in the present invention to detect the effect of the PCR reaction solution before and after adjustment on the direct amplification of blood, and the specific operation steps are as follows:

[0057] (1), respectively prepare two groups (4 PCR reactions to be tested) in 200 microliter centrifuge tubes, a total of 8 PCR reaction systems, the added components of the PCR system of each reaction to be tested include: 1 microliter Plasmid DNA template, 0-4 μl of human EDTA-2K anticoagulated blood sample, 1 μl of upstream primer (Pls-F: CCATAGCTGGCATAATGCCTGAC) at a concentration of 5 μmol / L, 1 μl of a concentration of 5 μmol / L The downstream primer (Pls-R: TCGAGTATCTGCAGGCTGTGTCATT), 10 microliters of PCR reaction solution and 0.4 microliters of DNA polymerase, and finally make up the PCR reaction system to 20 microliters with deionized water.

[0058] The plasmid DNA template described therein is pLB plasmid, and th...

Embodiment 3

[0068] The method of the invention detects the resistance of commonly used blood anticoagulants. Detect the inventive method to dipotassium ethylenediaminetetraacetic acid (EDTA-2K), the direct amplification effect of sodium heparin and sodium citrate anticoagulant blood, concrete operating steps are as follows:

[0069] (1), in the centrifuge tube of 200 microliters, prepare respectively three groups (each group 8 PCR reactions to be tested) altogether 24 PCR reaction systems to be tested and a negative control PCR reaction system, the PCR system of each sample to be tested The added components include: 2 μl of human anticoagulated blood sample, 1 μl of upstream primer (Prp-F: GCAGAGCAGTCATTATGGCGAAC) with a concentration of 5 μmol / L, and 1 μl of downstream primer with a concentration of 5 μmol / L (Prp-R: CCCACTATCAGGAAGATGAGGAAA) and 10 microliters of PCR reaction solution, and finally make up the PCR reaction system to 20 microliters with deionized water. The PCR system of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Taq DNA polymerase, and PCR (polymerase chain reaction) fluid and application thereof. Compared with SEQ ID NO:1, the amino acid sequence of the Taq DNA polymerase has following mutations: p.E641K, p.Q698E, and p.E708Q or p.E708D. By the Taq DNA polymerase, blood resistance and PCR inhibitor are improved obviously, and blood samples and soil samples can be directly used for PCR detection. Therefore, experimental time and cost can be greatly saved for experimenters, inter-sample cross contamination caused by multi-step operation can be avoided, and PCR detection results are more credible; an alternative way is provided for PCR detection of precious micro samples.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular, the invention relates to Taq DNA polymerase, PCR reaction solution and application thereof. Background technique [0002] Polymerase chain reaction (PCR) is a basic and important experimental technique in the field of modern molecular biology. With the development of PCR technology, PCR technology is more and more applied to molecular diagnosis and identification, especially in genetic disease diagnosis, pathogenic microorganism identification, blood typing, blood bank establishment, environmental monitoring, soil microbial analysis and forensic identification, etc. The applications are very extensive. [0003] However, existing PCR techniques still need improvement. Contents of the invention [0004] The present invention is based on the inventor's discovery and recognition of the following facts and problems: [0005] The template DNA of the PCR reaction mainly comes from blood ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/70C12N1/21C12N15/10C12R1/19
CPCC12N9/1252C12Y207/07007
Inventor 张双宇刘玉方李晓晨孙克非
Owner TIANGEN BIOTECH BEIJING
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com