7 results about "RELA" patented technology

Disclosed herein are methods of diagnosing severity, aggressiveness, or prognosis of a solid cancer by determining if miR-155 is overexpressed. Also disclosed herein are methods of treating, preventing, decreasing, eliminating, and / or ameliorating a cancer by synthetic nucleic acids encoding administering inducible T-cell costimulatory ligand (ICOSL) and / or RELA, thereby upregulating ICOSL and MHC-I on cancerous cells to improve the efficacy of immune cell therapies and checkpoint inhibitors. Any of the disclosed methods can further be paired with administration of an miR-155 inhibitor (e.g., cobomarsen).

The invention relates to a membrane fusion liposome delivery system and a preparation method and application thereof, and belongs to the technical field of liposome preparation. The invention provides a membrane fusion liposome delivery system. The system takes lipidosome as a carrier, the surface of the lipidosome is modified with cRGD targeting molecules, and the interior of the lipidosome is loaded with a TPP-modified antitumor drug lonidamine; a DNA device CLTD is anchored on a liposome membrane through cholesterol, and the device is formed by a short-chain CAP containing an APE1 restriction enzyme cutting site and a long-chain LTD containing a CD63 aptamer and a RelA aptamer through base complementary pairing. The APE1 enzyme highly expressed in a tumor microenvironment is used as a specific trigger signal, and precise activated release of the drug in tumor cells and space-time controllable degradation of RelA protein are achieved. According to the system, chemical drug inhibition and nucleic acid aptamer mediated protein degradation are synergistically linked, off-target toxicity is effectively overcome, and a new strategy is provided for precise treatment of cancers.

This invention provides an L-homoserine-producing strain, its construction method, and its applications. The strain does not contain plasmids. E.coli W3110, as a chassis strain, had the relA and thrB genes knocked out, and heterologously expressed genes derived from... Clostridium acetobutylicum The gapC gene and the aspB gene derived from Bacillus subtilis were overexpressed, along with ppc, asd, and thrA. fbr ,rhtA,pntAB,spoT fbr Genes; the strain described above can effectively improve the L-homoserine synthesis efficiency by knocking out genes of the L-homoserine degradation pathway, enhancing the expression of key enzymes in the pathway, optimizing the L-homoserine transport system, increasing the reducing power NADPH content, and enhancing the ability to withstand amino acid starvation. It is genetically stable, requires no addition of resistance substances, has high acid production efficiency, and has good L-homoserine synthesis capacity.

The invention discloses a recombinant engineering bacterium, a preparation method thereof and application of the recombinant engineering bacterium in preparation of antithrombotic drugs, and belongs to the technical field of biological medicines. The recombinant engineering bacterium is prepared by taking salmonella typhimurium with relA and spoT gene mutations as a carrier and introducing a recombinant plasmid containing a thrombolytic enzyme coding gene into the carrier. The invention provides a recombinant engineering bacterium with biological safety, the recombinant engineering bacterium has high thrombus targeting property under a dynamic blood flow condition, various thrombus models can be specifically targeted, and the concentration of the recombinant engineering bacterium in thrombus tissues can reach more than ten thousand times of the concentration of normal tissues such as spleen, liver and the like through bacterium proliferation. Through mediated thrombus targeted therapy, thrombus can be effectively dissolved, and revascularization is achieved. The invention provides a more effective and safer treatment strategy for diseases caused by thrombus, such as myocardial infarction, cerebral apoplexy, pulmonary embolism and the like.

The invention discloses a marker and a kit for predicting the risk of non-small cell lung cancer and application of the marker and the kit, and belongs to the technical field of biology, the marker is an RELA gene existing in lower-layer platelets, the kit comprises a primer and a probe for detecting the RELA gene, and the nucleotide sequence of the primer and the nucleotide sequence of the probe are as follows: RELA-F: GCTACACAGGACCAGGGACAGGT; the RELA-R is GCAGAGCCGCACAGCATTCA, the RELA-R is RELA-R, and the Wherein, RELA-oligo: ACCGGCCTACACCCCACCGAG, RELA-oligo: The application is used for predicting the risk of non-small cell lung cancer. Based on dPLTs RELA expression level detection, the specificity of the kit is superior to that of a traditional serum tumor marker, reliable risk assessment can be provided in the early stage of tumor occurrence, and the kit has important value and significance for clinical early screening, layered diagnosis and treatment and reduction of unnecessary invasive inspection.

The invention provides an L-homoserine production strain as well as a construction method and application thereof. The strain does not contain plasmids, E.coli W3110 is taken as a chassis strain, relA and thrB genes are knocked out, a gapC gene from Clostridium acetobutylicum is heterologously expressed, an aspB gene from bacillus subtilis is expressed, and ppc, asd, thrAfbr, rhtA, pntAB and spoTfbr genes are overexpressed; by knocking out L-homoserine decomposition pathway genes, enhancing expression of pathway key enzymes, optimizing an L-homoserine transport system, improving the reducing power NADPH content and enhancing the amino acid hunger resistance, the strain can effectively improve the synthesis efficiency of L-homoserine, is stable in heredity, does not need to add resistant substances, is high in acid production efficiency, and is suitable for industrial production. And the L-homoserine has good L-homoserine synthesis capability.

The present invention relates to a recombinant bacterial persister strain, comprising an expression cassette having a nucleic acid sequence of a relA gene or a functional fragment thereof, operably linked to a nucleic acid sequence of an inducible promoter.