Streptomyces diastatochromogenes with high yield of toyocamycin in genetic engineering as well as construction method and application of streptomyces diastatochromogenes
A technology for producing Streptomyces chromogenes and toyomycin, applied in the directions of genetic engineering, microorganism-based methods, applications, etc., can solve the problems of increased production of toyomycin, inability to carry out industrial production, difficulty in screening secondary metabolites, etc. , to achieve the effect of increasing production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Construction of RelA overexpression genetically engineered strains:
[0027] (1) Using the Streptomyces coelicolor genome as a template, using primers RelA-F and RelA-D as primers, PCR amplifies the RelA gene containing two restriction sites, NdeI and XbaI, and connects it to the pMD19 plasmid to construct pMD19- RelA vector, the vector was introduced into E.coli JM109 competent, spread on the LB agar plate containing ampicillin resistance, cultured overnight at 37°C, and sent to the company for sequencing analysis after enzyme digestion and identification.
[0028] The RelA gene sequence is shown in SEQ ID No.1
[0029] The sequences of the primers RelA-F and RelA-D are (the underline is the restriction site):
[0030] RelA-F:GGAATTC catatg CCAGACGAGGCCCAGCCACTGACCG (SEQ ID No. 2);
[0031] RelA-D:GC tctaga CTAGGGGTCCTCGGTCTCCTTCTGCCAGTCG (SEQ ID No. 3);
[0032] (2) Digest the vector pMD19-RelA with NdeI and XbaI to obtain the RelA gene fragment, and connect it...
Embodiment 2
[0036] Verification of Fermentation Performance of Amylase Streptomyces Chromogenes Original Strain and Recombinant Strain
[0037] The amylase Streptomyces chromogenes and the wild-type S.diastatochromogenes1628 strain genetically engineered to produce high toyocamycin were inoculated on the GYM plate, and cultured at 25-37° C. for 4 days until spores were produced. Then the spores were inoculated in 60 mL of fresh GYM medium, and cultured on a shaker at 25-37° C. at 200 rpm for 2 days to make a seed solution. Transfer to 60mL of fresh GYM medium, culture on a shaker at 25-37°C, 150-250rpm for 4 days to obtain toyocamycin mother liquor, and use HPLC method to determine the yield of toyocamycin. As shown in Table 1, the toyocamycin yield of the recombinant strain was higher than that of the original strain, and the final yield of toyocamycin of the recombinant strain reached x mg / L, which was increased by x% compared with the original strain, and the repeatability was good. I...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap