Streptomyces diastatochromogenes with high yield of toyocamycin in genetic engineering as well as construction method and application of streptomyces diastatochromogenes

A technology for producing Streptomyces chromogenes and toyomycin, applied in the directions of genetic engineering, microorganism-based methods, applications, etc., can solve the problems of increased production of toyomycin, inability to carry out industrial production, difficulty in screening secondary metabolites, etc. , to achieve the effect of increasing production

Active Publication Date: 2021-12-17
CHINA JILIANG UNIV
View PDF9 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Toyocamycin is a secondary metabolite of Streptomyces. The synthesis pathway is complex and regulated by multiple regulatory factors in the microorganism. The regulation of a single pathway gene cannot greatly increase the yield of the product
At present, the yield of toyocamycin is relatively low, and industrial production cannot be carried out
The production of secondary metabolites can be increased by means of ultraviolet mutagenesis, but due to the difficulty of screening secondary metabolites, large-scale screening is required to obtain high-yielding strains
CN201310170658.2, CN201310170665.2, CN201310168066.7, CN201310170674.1, CN201310168980.1, CN201410783862.6, CN201510966008.8, etc. have reported that by enhancing the expression of amylase and the production of some genes of chromogenic Streptomyces Research on improving the yield of toyocamycin by screening drug-resistant mutant strains, but the increase in yield of toyocamycin is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptomyces diastatochromogenes with high yield of toyocamycin in genetic engineering as well as construction method and application of streptomyces diastatochromogenes
  • Streptomyces diastatochromogenes with high yield of toyocamycin in genetic engineering as well as construction method and application of streptomyces diastatochromogenes
  • Streptomyces diastatochromogenes with high yield of toyocamycin in genetic engineering as well as construction method and application of streptomyces diastatochromogenes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Construction of RelA overexpression genetically engineered strains:

[0027] (1) Using the Streptomyces coelicolor genome as a template, using primers RelA-F and RelA-D as primers, PCR amplifies the RelA gene containing two restriction sites, NdeI and XbaI, and connects it to the pMD19 plasmid to construct pMD19- RelA vector, the vector was introduced into E.coli JM109 competent, spread on the LB agar plate containing ampicillin resistance, cultured overnight at 37°C, and sent to the company for sequencing analysis after enzyme digestion and identification.

[0028] The RelA gene sequence is shown in SEQ ID No.1

[0029] The sequences of the primers RelA-F and RelA-D are (the underline is the restriction site):

[0030] RelA-F:GGAATTC catatg CCAGACGAGGCCCAGCCACTGACCG (SEQ ID No. 2);

[0031] RelA-D:GC tctaga CTAGGGGTCCTCGGTCTCCTTCTGCCAGTCG (SEQ ID No. 3);

[0032] (2) Digest the vector pMD19-RelA with NdeI and XbaI to obtain the RelA gene fragment, and connect it...

Embodiment 2

[0036] Verification of Fermentation Performance of Amylase Streptomyces Chromogenes Original Strain and Recombinant Strain

[0037] The amylase Streptomyces chromogenes and the wild-type S.diastatochromogenes1628 strain genetically engineered to produce high toyocamycin were inoculated on the GYM plate, and cultured at 25-37° C. for 4 days until spores were produced. Then the spores were inoculated in 60 mL of fresh GYM medium, and cultured on a shaker at 25-37° C. at 200 rpm for 2 days to make a seed solution. Transfer to 60mL of fresh GYM medium, culture on a shaker at 25-37°C, 150-250rpm for 4 days to obtain toyocamycin mother liquor, and use HPLC method to determine the yield of toyocamycin. As shown in Table 1, the toyocamycin yield of the recombinant strain was higher than that of the original strain, and the final yield of toyocamycin of the recombinant strain reached x mg / L, which was increased by x% compared with the original strain, and the repeatability was good. I...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides streptomyces diastatochromogenes with high yield of toyocamycin in genetic engineering as well as a construction method and application of the streptomyces diastatochromogenes. According to the method, a recombinant plasmid pIB139-RelA is constructed by a genetic engineering method, and is transferred into streptomyces diastatochromogenes 1628, the streptomyces diastatochromogenes with high yield of toyocamycin overexpresses a streptomyces coelicolor ppGpp synthetase RelA gene, and the overexpression product of the RelA gene can positively regulate and control the biosynthesis of toyocamycin, and is used for the production of toyocamycin. The yield of toyocamycin produced by fermentation of the strain obtained by the invention is at least increased to 1568mg / L, which is 10 times of the yield of the original strain, and a new technical support is provided for increasing the yield of toyocamycin in industrial production.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a genetically engineered bacterial strain and a construction method thereof, in particular to an amylase chromogenous Streptomyces chromogenicum with a high yield of toyocamycin by genetic engineering, a construction method and application thereof. Background technique [0002] Toyocamycin is a nucleoside antibiotic with the molecular formula C 12 h 13 N 5 o 4 , Ribose C1 is connected to a deazapurine ring similar to guanine, and the core structure is a pyrropyrimidine nucleoside analogue. Its mechanism of action is mainly to affect the growth of bacteria by inhibiting the transport of microorganisms, and can be widely used in medical, pharmaceutical, agricultural and other fields. In recent years, it has been found that toyocamycin can be used as an agricultural antibiotic to inhibit the growth of various plant pathogenic fungi, such as Fusarium wilt of cucumber and sheath blight ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/74C12N15/66C12P19/40C12R1/525
CPCC07K14/36C12N15/74C12N15/66C12P19/40Y02A50/30
Inventor 宋阳申屠旭萍俞晓平张祥丽张子轩
Owner CHINA JILIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap