Method for improving rice resistance to bacterial leaf blight by using leaf specific expression artificial microRNA

A leaf blight resistance and specific technology, applied in the field of plant genetic engineering, can solve the problems of pollen fertility decline and expression decline, and achieve the effect of reducing fertility decline

Inactive Publication Date: 2011-02-23
HUAZHONG AGRI UNIV
View PDF1 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no difference between xa13 and its dominant allele Xa13 in the coding region of the gene, but the sequence variation in the promoter part of xa13 leads to a significant decrease in its expression in rice leaves, so that the rice plants acquire specificity to Xanthobacterium blight strain PXO99 resistance
Constitutive suppression of the xa13 allelic dominant gene Xa13 expression can increase rice resistance to strain PXO99, but at the same time lead to a significant decrease in pollen fertility, indicating that this gene not only controls rice disease resistance but is also related to rice fertility (Bart et al.2006; Chu et al.2006)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving rice resistance to bacterial leaf blight by using leaf specific expression artificial microRNA
  • Method for improving rice resistance to bacterial leaf blight by using leaf specific expression artificial microRNA
  • Method for improving rice resistance to bacterial leaf blight by using leaf specific expression artificial microRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Design of amiRNA sequence and construction of amiRNA precursor

[0029] Obtain the sequence number "DQ421395" of the Xa13 gene in Genebank according to the literature published by Chu et al. According to the sequence of DQ421395, perform blastn on the TIGR Rice website (http: / / rice.plantbiology.msu.edu / LocusNameSearch.shtml) to obtain its locus identifier in TIGR Rice: Os08g42350.1. On the Web MicroRNA Designer webpage (http: / / wmd3.weigelworld.org / cgi-bin / webapp.cgi?page=Designer; project=stdwmd) input Os08g42350.1, the software returns 17 amiRNA sequences of Xa13, manually screened out Two of them were named amiA (sequence TAGACTACTAGTAGATCCGCT) and amiB (sequence TGTAGCGAGAATCTGTCGCCG) for further research.

[0030] Referring to the method published by Warthmann et al. (2008), using the plasmid pNW55 as a template (containing the precursor sequence of the rice natural miRNA Osa-miR528, donated by Prof. Detlef Weigel from the Max Planck Institute of Developmen...

Embodiment 2

[0046] Example 2 Obtaining of leaf-specific expression promoter

[0047] According to the master's degree thesis of Huang Haiqun, the State Key Laboratory of Crop Genetic Improvement of Huazhong Agricultural University, the primers OsrbcS-F and OsrbcS-R of the rice rbcS promoter Osrbcsp, and the primer sequence AtrbcS- of the Arabidopsis rbcS1A promoter Atrbcsp were obtained. F and AtrbcS-R (see Table 1). The promoters Osrbcsp and Atrbcsp of rbcs genes in rice (genotype Nipponbare) and Arabidopsis (genotype Col) were amplified respectively by using these two pairs of primers. The PCR reaction system was: 5 μl of 10xPCR buffer, 5 μl of 2mM dNTPs, 2 μl of each 10 μM primer, 20 ng of large sample DNA, 0.5 μl of LA Taq (purchased from Treasure Bioengineering Dalian Co., Ltd.), and sterilized double-distilled water was added to 50 μl. Reaction conditions: 94°C for 2min; 32 cycles of 94°C for 45s, 57°C for 2min, 72°C for 45s; 72°C for 7min. Take 10 μl of the PCR product and run 1%...

Embodiment 3

[0048] The construction of embodiment 3 plant expression vectors

[0049] First digest the plasmid PUC-Bt (this plasmid is artificially synthesized by our laboratory and contain the NOS terminator of the nopaline synthase gene of 0.3 kb) with restriction endonucleases EcoR I and Sac I to obtain the NOS terminator of 0.3 kb, which will be recovered The NOS terminator was constructed on the pCAMBIA1300 vector which was also cut with EcoR I and Sac I ( figure 1 , the plasmid was donated by the CAMBIA laboratory in Australia) to form the intermediate vector pC1300-Nos ( figure 2 ).

[0050] Utilize Kpn I and BamHI double enzymes to digest the T-easy vector containing the amiA and amiB precursor sequences, and construct the vector pC1300-amiA-Nos ( image 3 ) and pC1300-amiB-Nos ( Figure 4 ).

[0051] The promoter Osrbcsp cloned on the T-vector was excised with Pst I and Hind III, and constructed on the intermediate vectors pC1300-amiA-Nos and pC1300-amiB-Nos cut with the sam...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of plant gene engineering, in particular to design, verification and application of a rice disease resistance related DNA molecule of 21nt. An artificial microRNA sequence of the 21nt is artificially designed, and an artificial microRNA precursor is constructed by using a natural microRNAosa-mi528 precursor as a skeleton. In transgenic rice, the artificial microRNA precursor is specifically expressed by using a leaf specific promoter of a rice or arabidopsis thaliana source so that the resistance of the transgenic rice to bacterial leaf blight can be enhanced and important agronomic traits of the transgenic rice such as fertility and the like is not affected at the same time.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering. It specifically involves the design, verification and application of a 21nt rice disease resistance-related DNA molecule. The present invention artificially designs a 21nt artificial microRNA sequence, and uses the natural microRNA osa-MIR528 precursor as a skeleton to construct the artificial microRNA precursor. In transgenic rice, the leaf-specific expression of the precursor of this artificial microRNA can enhance the resistance of transgenic rice to bacterial blight without affecting the fertility and other important agronomic traits of transgenic rice. Background technique [0002] Disease resistance and insect breeding are one of the main breeding goals in agricultural production. In disease resistance and insect breeding, resistance gene resources are the most important. Therefore, breeders and biologists conduct large-scale identification in a large number of cultivat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A01H5/00C12N15/82
Inventor陈浩李昌焱林拥军
OwnerHUAZHONG AGRI UNIV