Primer, probe, test kit and method for testing genetically modified rice or products thereof
A technology of transgenic rice and kits, applied in biochemical equipment and methods, measurement/testing of microorganisms, DNA/RNA fragments, etc., to achieve the effects of strong ability to initiate transcription, solve post-PCR pollution, and stable expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] This example tests the specificity of transformation events by using the primer pairs and probes of the present invention.
[0038] Transformation event specificity was tested by detecting the maize ubiquitin promoter sequence.
[0039] Using the combination of the primer pair and the probe of the present invention, compared with other primer pairs, the target fragment can still be amplified specifically and sensitively in the case of a very small sample amount.
[0040] The primer pairs and probe sequences used to detect the specificity of transformation events used in this example are:
[0041] Ubiquitin-F2: TAGCCCTGCCTTCATACGCTA (SEQ ID No. 1)
[0042] Ubiquitin-R2: TGATCCTCTAGAGTCGACCTGC (SEQ ID No. 2)
[0043] Ubiquitin-P2: TGTCGATGCTCACCCCTGTTGTTTGGTGT (SEQ ID No.3), a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.
[0044] In this example, 14 samples were tested: Kefeng...
Embodiment 2
[0073] In this embodiment, the sensitivity test of the primer pair and probe of the present invention is carried out through the following tests.
[0074] The primer pairs and probe sequences used to detect the sensitivity of transformation events used in this example are:
[0075] The primers are SEQ ID No.1 and SEQ ID No.2;
[0076] The probe is SEQ ID No.3, a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.
[0077] The DNA extraction steps and the PCR reaction system are the same as those described in Example 1.
[0078] In order to determine the detection limit of the combination of specific primers and probes, taking Kefeng 6 as an example, 100ng of 5% (W / W) transgenic rice Kefeng 6 DNA with a relative mass fraction of 5% was diluted 4-fold in no Bacterial water, carry out real-time fluorescent PCR amplification according to the condition described in embodiment 1 respectively, th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 