Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer, probe, test kit and method for testing genetically modified rice or products thereof

A technology of transgenic rice and kits, applied in biochemical equipment and methods, measurement/testing of microorganisms, DNA/RNA fragments, etc., to achieve the effects of strong ability to initiate transcription, solve post-PCR pollution, and stable expression

Inactive Publication Date: 2013-02-13
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0014] At present, there are few reports at home and abroad that can quickly, simply, specifically and sensitively detect transgenic rice and its products containing maize ubiquitin promoter

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, test kit and method for testing genetically modified rice or products thereof
  • Primer, probe, test kit and method for testing genetically modified rice or products thereof
  • Primer, probe, test kit and method for testing genetically modified rice or products thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] This example tests the specificity of transformation events by using the primer pairs and probes of the present invention.

[0038] Transformation event specificity was tested by detecting the maize ubiquitin promoter sequence.

[0039] Using the combination of the primer pair and the probe of the present invention, compared with other primer pairs, the target fragment can still be amplified specifically and sensitively in the case of a very small sample amount.

[0040] The primer pairs and probe sequences used to detect the specificity of transformation events used in this example are:

[0041] Ubiquitin-F2: TAGCCCTGCCTTCATACGCTA (SEQ ID No. 1)

[0042] Ubiquitin-R2: TGATCCTCTAGAGTCGACCTGC (SEQ ID No. 2)

[0043] Ubiquitin-P2: TGTCGATGCTCACCCCTGTTGTTTGGTGT (SEQ ID No.3), a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.

[0044] In this example, 14 samples were tested: Kefeng...

Embodiment 2

[0073] In this embodiment, the sensitivity test of the primer pair and probe of the present invention is carried out through the following tests.

[0074] The primer pairs and probe sequences used to detect the sensitivity of transformation events used in this example are:

[0075] The primers are SEQ ID No.1 and SEQ ID No.2;

[0076] The probe is SEQ ID No.3, a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.

[0077] The DNA extraction steps and the PCR reaction system are the same as those described in Example 1.

[0078] In order to determine the detection limit of the combination of specific primers and probes, taking Kefeng 6 as an example, 100ng of 5% (W / W) transgenic rice Kefeng 6 DNA with a relative mass fraction of 5% was diluted 4-fold in no Bacterial water, carry out real-time fluorescent PCR amplification according to the condition described in embodiment 1 respectively, th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an oligonucleotides primer and probe for testing genetically modified rice containing an ubiquitin promoter or products thereof. The invention relates to a real-time fluorescent PCR (Polymerase Chain Reaction) testing method of the genetically modified rice containing the ubiquitin promoter or products thereof, in which the specific oligonucleotides primer and the probe are used. The invention also relates to a test kit for testing the genetically modified rice containing the ubiquitin promoter or products thereof, which comprises the specific oligonucleotides primer and the probe. The invention also relates to the application of the specific oligonucleotides primer and the probe or the test kit to testing the genetically modified rice containing the ubiquitin promoter or products thereof. By using the specific oligonucleotides prime, the probe, the test kit and the PCR testing method, the genetically modified rice containing the ubiquitin promoter or products thereof can be tested simply, quickly, specifically and sensitively.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the invention relates to oligonucleotide primers, probes, and kits for detecting transgenic rice containing maize ubiquitin promoter or its products, and for determining The real-time fluorescent PCR detection method of transgenic rice or its products, and the application of specific oligonucleotide primers and probes or kits of the present invention in detecting transgenic rice containing maize ubiquitin promoter or its products. Background technique [0002] Genetically modified organisms refer to the use of biotechnology to transfer foreign genes to other species to modify their genetic characteristics, so as to obtain the traits and nutritional qualities required by human beings. Foods that are processed from genetically modified organisms or their raw materials are genetically modified foods. Since the first genetically modified food (transgenic tomato) was born in the United Stat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11G01N21/64
Inventor 黄文胜邓婷婷韩建勋陈颖
Owner CHINESE ACAD OF INSPECTION & QUARANTINE