Structural variants of antibodies for improved therapeutic characteristics

A technology of antibodies, therapeutics, applied in the field of structural variants of antibodies for improved therapeutic characteristics, capable of addressing bone marrow adverse effects, severe infections, etc.

Active Publication Date: 2011-08-17
IMMUNOMEDICS INC
View PDF81 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These drugs also suppress the entire immune system, can cause serious infections, and have adverse effects on the bone marrow, liver, and kidneys

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Structural variants of antibodies for improved therapeutic characteristics
  • Structural variants of antibodies for improved therapeutic characteristics
  • Structural variants of antibodies for improved therapeutic characteristics

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0191] Example 1. Construction of chimeric and humanized anti-CD20 antibodies

[0192] Chimeric (cA20) and humanized (hA20, veltuzumab) anti-CD20 antibodies were constructed as described in U.S. Patent No. 7,151,164, the Examples section of which is incorporated herein by reference (see also, Stein et al., Clin Cancer Res. 2004; 10: 2868-2878). The variable region DNA and amino acid sequence profiles of cA20 and hA20 are disclosed in Figures 1 and 2.

[0193] The CDR sequences of cA20 and hA20 are identical to those of rituximab (parental murine MAb C2B8), except for the third CDR of the heavy chain (CDRH3). For convenience, the heavy chain CDR sequences are referred to as CDRH1-H3 and the light chain CDRs as CDRL1-L3. Of the reported CDRH3 sequences of anti-CD20 antibodies, only C2B8 and the corresponding rituximab have an asparagine residue at Kabat position 101.

[0194] The framework region sequences of veltuzumab (hA20) were constructed using the same human IgG donor f...

Embodiment 2

[0200] Example 2. Construction of the D101N sequence variant of veltuzumab

[0201] All restriction endonucleases and other enzymes were purchased from New England Biolabs (Beverly, MA). Oligonucleotides were synthesized by Sigma Genosys (Haverhill, UK). PCR reactions were performed using Amplitaq polymerase (Applied Biosystems, Foster City, CA) and a Perkin Elmer (Wellesley, MA) GeneAmp PCR system 9600. The hA20-pdHL2 (see U.S. Pat. No. 7,151,164) vector was used as a template and the oligonucleotide primer pair 5' D101N (cggtgactggtacttcaatgtctggggccaaggcaccacg SEQ ID NO: 17) and 3' Hind3 (aaagcttgcggccgcgatcc SEQ ID NO: 18) or 3' D101ccN (cggtgtaggact Two PCR reactions of taccagtcaccg SEQ ID NO: 19) and 5' XhoI (cctcgagcacacaggacctc SEQ ID NO: 20) generated 210 bp or 510 bp amplification primers, respectively. A third PCR reaction using a mixture of 210 bp and 510 bp products as template and 5' XhoI and 3' Hind3 primers generated 680 bp amplification primers, which were g...

Embodiment 3

[0202] Example 3. Scatchard Analysis of Binding of Anti-CD20 Antibodies

[0203] cell line

[0204] In the following examples, the murine hybridoma 1F5 and the human Burkitt's lymphoma lines Daudi, Raji and Ramos were purchased from the American Type Culture Collection (Manassas, VA). The non-Burkitt lymphoma cell lines used were: SU-DHL-6 from Dr. Alan Epstein (University of Southern California, Los Angeles, CA) and WSU from Dr. Mitchell Smith (Fox Chase Cancer Center, Philadelphia, PA) -FSCCL. Cultured in DMEM (Life Technologies, Inc. Gaithersburg, MD) supplemented with 10% fetal bovine serum, penicillin (100 units / ml), streptomycin (100 μg / ml) and L-glutamine (2 mM) cells, as a suspension culture.

[0205] Scatchard Analysis

[0206] The maximum number of binding sites per Raji cell and veltuzumab was determined by nonlinear regression analysis of saturated binding data obtained with radioiodinated samples and Raji cells using Prism software (GraphPad Software Inc., San...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides substituted humanized, chimeric or human anti-CD20 antibodies or antigen binding fragments thereof and bispecific antibodies or fusion proteins comprising the substituted antibodies or antigen binding fragments thereof. The antibodies, fusion proteins or fragments are useful for treatment of B-cell disorders, such as B-cell malignancies and autoimmune diseases, as well as GVHD, organ transplant rejection, and hemolytic anemia and cryoglobulinemia. Amino acid substitutions, particularly substitution of an aspartate residue at Kabat position 101 of CDR3 VH (CDRH3), result in improved therapeutic properties, such as decreased dissociation rates, improved CDC activity, improved apoptosis, improved B-cell depletion and improved therapeutic efficacy at very low dosages. Veltuzumab, a humanized anti-CD20 antibody that incorporates such sequence variations, exhibits improved therapeutic efficacy compared to similar antibodies of different CDRH3 sequence, allowing therapeutic effect at dosages as low as 200 mg or less, more preferably 100 mg or less, more preferably 80 mg or less, more preferably 50 mg or less, most preferably 30 mg or less of naked antibody when administered i.v. or s.c.

Description

[0001] related application [0002] This application claims the benefit of U.S. Provisional Patent Application Serial No. 61 / 082,399, filed July 21, 2008, under 35 U.S.C. 119(e). Background of the invention [0003] technology field. [0004] The present invention relates to structural variants of anti-CD20 antibodies and / or antigen-binding fragments thereof having improved therapeutic characteristics, preferably comprising the amino acid sequences of the complementarity determining regions (CDRs). In specific embodiments, the structural variant may comprise a change in the third CDR sequence of the antibody heavy chain (CDRH3), eg, replacement of an asparagine residue at Kabat position 101 with an aspartic acid residue. In other specific embodiments, said structural variant may comprise an arginine residue at Kabat position 94, which may form a salt bridge with an aspartic acid at Kabat position 101. In other specific embodiments, said structural variant may comprise a val...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/395C07K16/18
CPCC07K2317/565A61K2039/545A61K2039/505C07K2317/24C07K2317/734C07K2317/732C07K16/2887A61P13/12A61P17/00A61P19/02A61P29/00A61P35/00A61P35/02A61P35/04A61P37/00A61P37/02A61P37/06A61P43/00A61P7/00A61P7/06A61P9/00A61K39/395C07K14/00C07K14/47C07K16/18
InventorD·M·戈登伯格C-H·张H·J·汉森
OwnerIMMUNOMEDICS INC