Method for rapid detection of drug resistant gene New Delhi metallo-beta-lactamase in bacteria

A technology of lactamase and drug-resistant genes, applied in the biological field, to achieve the effect of eliminating non-specific amplification

Inactive Publication Date: 2011-10-19
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of in vitro protein cell-free expression system for bla NDM-1 Genetic testing has not yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapid detection of drug resistant gene New Delhi metallo-beta-lactamase in bacteria
  • Method for rapid detection of drug resistant gene New Delhi metallo-beta-lactamase in bacteria
  • Method for rapid detection of drug resistant gene New Delhi metallo-beta-lactamase in bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] A rapid assay for the detection and characterization of the drug-resistant gene New Delhi β-lactamase in bacteria (full-length amplified by PCR containing the T7 promoter bla NDM-1 gene for detection of β-lactamase resistance gene and characterization of its encoded enzyme in New Delhi), the steps are:

[0036] 1. Boiling and lysing Mycobacterium tuberculosis to quickly prepare templates for PCR reactions:

[0037] Take a small amount (about 100 – 10000 bacteria) containing bla NDM-1 Genetic strains (e.g. containing bla NDM-1 Genetic Escherichia coli, Klebsiella pneumoniae and Klebsiella stinky nose, etc.) add 100ul double distilled water to boil for 10min, then centrifuge at 13000rpm for 5min, and carefully draw the supernatant as amplification bla NDM-1 Gene template.

[0038] 2. PCR amplification bla NDM-1 Gene primer design. Upstream primer sequence P1: TAATACGACTCACTATAGGATGGAATTGCCCAATATTATGCA 3', downstream primer sequence: 5' TCAGCGCAGCTTGTCGGCCATGC 3'...

Embodiment 2

[0059] Full-length PCR amplification with T7 promoter and 5' UTR enhancer bla NDM-1 Genes used in the detection of β-lactamase resistance genes and characterization of their encoded enzymes in New Delhi:

[0060] 1. Boiling and lysing Mycobacterium tuberculosis to quickly prepare templates for PCR reactions:

[0061] Take a small amount (about 100 – 10000 bacteria) containing bla NDM-1 Genetic strains (e.g. containing bla NDM-1 Genetic Escherichia coli, Klebsiella pneumoniae and Klebsiella stinky nose, etc.) add 100ul double distilled water to boil for 10min, then centrifuge at 13000rpm for 5min, and carefully draw the supernatant as amplification bla NDM-1 Gene template.

[0062] 2. PCR amplification bla NDM-1 Gene primer design. Upstream primer sequence P2: 5' TAATACGACTCACTATAGGATACTCCCCCACAACAGCTTACAATACTCCCCACACAGCTTACAAATACTCCCCATGGAATTGCCCAATATTATGCA 3';

[0063] Downstream primer sequence: 5'TCAGCGCAGCTTGTCGGCCATGC3'.

[0064] PCR amplification conditions: ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapid detection of a drug resistant gene New Delhi metallo-beta-lactamase (NDM-1) in bacteria, comprising the steps of: A. cracking or extracting DNA in bacteria to be detected so as to be used as a template of PCR (polymerase chain reaction); B. designing PCR primers and amplifying a full-length New Delhi metallo-beta-lactamase gene; C. condensing the amplified blaNDM-1 gene segment and quantifying; D. expressing blaNDM-1 enzyme with a wheat germ cell-free expression system; E. determining the activity of the expressed NDM-1 in degrading antibiotics. In the invention, the detection and characterization of the drug resistant gene New Delhi metallo-beta-lactamase in bacteria are realized by a pair of PCR primers and the determination of antibiotic degradation activity. Meanwhile, a primer sequence for amplifying the full-length blaNDM-1 gene and for expressing NDM-1 by the wheat germ cell-free expression system is disclosed. With feasibility, high sensitivity and simple operation, the method of the invention can be used for rapid detection. With a pair of PCR primers and by determination of antibiotic degradation activity, the detection and characterization of the drug resistant gene New Delhi metallo-beta-lactamase in bacteria come true.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically relates to a method for detecting and characterizing drug-resistant gene New Delhi β-lactamase based on a wheat germ cell-free in vitro protein expression system. It can be used to detect and confirm the drug-resistant gene New Delhi β-lactamase in various clinical bacteria. Background technique [0002] The resistance gene New Delhi β-lactamase (NDM-1) was identified in 2009 by Timothy Walsh of Cardiff University, UK. He found in multidrug-resistant Escherichia coli and Klebsiella pneumoniae isolated from a Swedish patient bla NDM-1. . The study found that by bla NDM-1 The encoded New Delhi β-lactamase (NDM-1) can decompose carbapenem antibiotics, and the latter is currently a class of antibiotics with the broadest antibacterial spectrum and strongest antibacterial activity in anti-infection therapy, and is widely used in the treatment of patients with severe infections. t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/34C12Q1/02
Inventor危宏平周满赵金凤张治平张先恩
OwnerWUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI