A method for detecting the single nucleotide polymorphism of cattle fgf21 gene

A single nucleotide polymorphism, FGF21 technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve blank and other problems

Inactive Publication Date: 2011-12-28
NORTHWEST A & F UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There is no research on the genetic variation of the FGF21 gene at home and abroad, and the research on the function of the gene locus and the relationship between genetic variation and economic traits (such as weight, etc.) is still blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for detecting the single nucleotide polymorphism of cattle fgf21 gene
  • A method for detecting the single nucleotide polymorphism of cattle fgf21 gene
  • A method for detecting the single nucleotide polymorphism of cattle fgf21 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0046] The present invention utilizes the PCR-RFLP method to detect the single nucleotide polymorphisms at the 159th, 297th, 940th, and 1151st positions of the cattle FGF21 gene. by way of explanation of the invention, not limitation.

[0047] A, design the PCR primers of cattle FGF21 gene

[0048] The full length of cattle FGF21 gene is 1459bp, including 3 exons and 2 introns. Using the bovine (NC_007316) sequence published by NCBI as a reference, use Primer 5.0 to design 3 pairs of primers to amplify the full length of the FGF21 gene (including 3 exons and 2 introns, a total of 11459bp) in 3 segments. The primers are as follows :

[0049] The primer pair P1 is:

[0050] Upstream primer: 5′ATGGGCTGGGACGAGGCCAAGTTC 3′,

[0051] Downstream primer: 5′CAAACCAAGCCTGACCAACATCAAA 3′;

[0052] The primer pair P2 is:

[0053] Upstream primer: 5′GGAAGCTGTACGGATCGGTGAG 3′,

[0054] Downstream primer: 5'CTCCTTTCTCAGCTTTATCGTCTAGG 3';

[0055] The primer pair P3 is:

[0056] Upst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an RFLP method for rapidly detecting the SNP of the cattle FGF21 gene. Using the whole genome DNA of the cattle to be tested containing the FGF21 gene as a template, using primer pairs P1, P2 and P3 as primers, the FGF21 gene of cattle is amplified by PCR, and 4 SNP sites; primer pairs F159, F297, F940, and F1151 were designed for these 4 SNP sites, and SalI, XhoI, XbaI, and MspI restriction sites were artificially introduced in turn for PCR amplification. The endonucleases digested the PCR amplification products respectively, and then detected the digested fragments by agarose gel electrophoresis, and identified the 159th, 297th, 940th, and 1151st units of the cattle FGF21 gene according to the electrophoresis results. Nucleotide polymorphism. Since the function of the FGF21 gene involves growth traits such as body weight, the detection method provided by the invention lays the foundation for the establishment of the relationship between the SNP of the FGF21 gene and the growth traits, so as to be used for marker-assisted selection of the growth traits of Chinese cattle, and to quickly establish cattle with excellent genetic resources. population.

Description

technical field [0001] The invention belongs to the field of molecular genetics, in particular to a RFLP (restriction fragment length polymorphism) for rapidly detecting the single nucleotide polymorphism (SNP) of the fibroblast growth factor 21 (fibroblast growth factor 21, FGF21) gene The method, specifically, is to use restriction endonucleases to digest the gene sequence containing the single nucleotide polymorphism site, separate the fragments according to the size of the agarose gel electrophoresis, and use the gel The imaging system analyzes its fragment size to determine its SNP. Background technique [0002] Single nucleotide polymorphism (SNP) refers to the polymorphism caused by the substitution of a single nucleotide (A / T / C / G) in the genomic DNA sequence. [0003] In recent years, people have developed many methods for searching molecular genetic markers, the most common ones are single-strand conformation polymorphism (SSCP), direct sequencing technology and PC...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
Inventor陈宏孙晓梅李明勋马伟蓝贤勇王璟滑留帅
OwnerNORTHWEST A & F UNIV