Preparation method for nucleic acid nano-particle wrapping pharmacological active substances
A nucleic acid nanoparticle and pharmacologically active technology, applied in drug combinations, pharmaceutical formulations, organic active ingredients, etc., can solve problems such as targeting limitations, achieve the effects of small medication volume, short medication time, and improved cost efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1. Circular DNA Primer Synthesis
[0043] Mix 5 μl of water, 1 μl of 10x reaction buffer, 0.5 μl of 1 mM ATP, 0.5 μl of 50 mM MnCl2, 2.5 μl of 100 μM linear DNA (CTCTACTACCTTCTCCCCCCCCAAAACGCAAACCCACTACCACCAAAC) and 0.5 μl of DNA cyclase ligase, react at 62°C for 2 hours, then 85°C React for 15 minutes to inactivate the cyclase enzyme. Samples were stored at -20°C.
Embodiment 2
[0044] Example 2. Rolling Circle Replication (RCA)
[0045] Mix 14.1 μl water, 2.5 μl Phi29 buffer, 2.5 μl 25 mM dNTPs, 4 μl 1% BSA, 2.5 μl 100 μM DTT, 2.5 μl 100 μM DNA template, 2.5 μl circular DNA primers and 0.25 μl 100U / μl Phi29, at 37°C The reaction was carried out for 3 hours. The RCA reaction product was detected by 1.2% agarose gel electrophoresis ( figure 1 ).
Embodiment 3
[0046] Example 3. Preparation of paclitaxel-nucleic acid nanoparticles
[0047] Take 2.5 μl of RCA reaction product, react at 80°C for two hours, add 0.6 μL of 25mM paclitaxel (dissolved in ethanol) solution after the end, mix for 2 minutes, put it into ice-water mixture, until the suspension is transparent, and the average The particle size is 50-200nm, (BIC 90plus Particle Size Analyzer). The encapsulation efficiency of paclitaxel was determined by a reversed-phase C18 column, the mobile phase was acetonitrile: water (60:40), and the detection wavelength was 227nm. HPLC analysis showed that the drug loading in this experiment was 1%.
PUM
| Property | Measurement | Unit |
|---|---|---|
| The average particle size | aaaaa | aaaaa |
| The average particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 