Supercharge Your Innovation With Domain-Expert AI Agents!

Factor for regulating toxicity of Candida albicans and its application

A technology of Candida albicans and toxicity, which is applied to the factors regulating the toxicity of Candida albicans and its application field, and can solve the problems that pathogenic factors and pathogenic mechanisms are not fully studied and the like.

Inactive Publication Date: 2012-02-01
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the real pathogenic factor and pathogenic mechanism of Candida albicans have not been fully studied, so it is necessary to study the pathogenic factor of Candida albicans in this field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Factor for regulating toxicity of Candida albicans and its application
  • Factor for regulating toxicity of Candida albicans and its application
  • Factor for regulating toxicity of Candida albicans and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0059] Monoclonal antibodies can be prepared using hybridoma technology (see Kohler et al., Nature 256; 495, 1975; Kohler et al., Eur.J.Immunol.6:511, 1976; Kohler et al., Eur.J.Immunol.6:292 , 1976; Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981). After the hybridoma cells are obtained, monoclonal antibody production techniques well known to those skilled in the art can be used to mass-produce the monoclonal antibody of the present invention. As an embodiment of the present invention, the monoclonal antibody can be prepared by the following preparation method, which includes the steps of: (1) providing adjuvant pretreated mice; (2) intraperitoneally inoculating the mice The hybridoma cells secrete monoclonal antibodies; (3) ascitic fluid is extracted, and the monoclonal antibodies are obtained by separation.

[0060] As a mode of the present invention, a composition is provided, which contains an effective amount (such as 0.0001-10wt%...

Embodiment 1

[0083] Example 1, knockout of CaASC1 gene in Candida albicans

[0084] In order to study the function of CaAsc1 in the morphogenesis and virulence expression of Candida albicans, the present inventors constructed a caasc1 / caasc1 deletion strain. Using the PCR homologous recombination strategy, in the wild-type strain BWP17 (ura-his-arg-) (see Wilson, R.B., D. Davis, and A.P. Mitchell, Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.J Bacteriol , 1999.181(6): p.1868-74.) knocked out the CaASC1 gene, the knockout strategy is as follows figure 1 As shown in A.

[0085] The PCR primers used for knockout are as follows:

[0086] CaASC1-5DR:

[0087] 5'-GTTAATTTCATTTCCCTTCAATTTCTTTTCTTTTCTTCTTTTTTAAAAAACAAACAATCAATTTATCTACGTTTTTCCCAGTCACGACGTT;

[0088] CaASC1-3DR:

[0089] 5'-TTTCCCACAAAAAAACAAAATCTATACAAAAAAAACTTCTTGTTGTATGTTAAAATTTAGAATTAAATTTGTGGAATTGTGAGCGGATA;

[0090] 69 bases in the primers CaASC1-5DR and CaASC1-3DR ar...

Embodiment 2

[0093] Example 2, the impact of knockout of CaASC1 gene on Candida albicans

[0094]The CaASC1 gene was knocked out in Candida albicans by homologous recombination. PCR and Southern blot analysis proved that the knockout was successful.

[0095] In order to detect whether the deletion of the CaASC1 gene affects the mycelial development of Candida albicans, the inventors tested the morphology of the following strains under the condition of mycelial induction. Serum is a strong hyphae-inducing factor. Adding 10% (v / v) serum to the rich liquid medium YPD and culturing at 37°C is a standard hyphae induction condition. Cultivate under these conditions for 3.5 hours, wild-type strain SC5314 (WT) (see Fonzi, W.A.and M.Y.Irwin, Isogenic strain construction and gene mapping in Candida albicans.Genetics, 1993.134 (3): p.717-28.) and The revertant strains of CaASC1 (caasc1 / caasc1+CaASC1) could form mycelium, while the CaASC1 / caasc1 single-copy deletion strain formed shorter mycelium. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a factor for regulating toxicity of Candida albicans and its application. The invention reveals that the CaASC1 gene is an important toxic factor in Candida albicans for the first time. The invention also discloses an attenuated strain of Candida albicans, and in the attenuated strain, the CaASC1 gene is not expressed on the whole.

Description

technical field [0001] The invention belongs to the field of biotechnology; more specifically, the invention relates to a factor regulating the toxicity of Candida albicans and its application. Background technique [0002] Candida albicans is an opportunistic human pathogenic fungus isolated clinically. It can cause extensive superficial and deep lesions in immunocompromised patients, such as organ transplant patients and HIV-infected patients. Systemic infection, the infection site includes the oral cavity, female vagina, etc., causing diseases such as thrush, vaginitis, etc. It can also invade the epidermis and endothelial cells into the blood and reach internal organs, such as kidneys, brain, etc., leading to sepsis, which can lead to death (Odds , F.C. 1994. J Am Acad Dermatol. 31:S2-S5). Under different growth conditions, Candida albicans presents different growth forms, including yeast form, pseudohyphae and hyphae. The mutual conversion ability between various form...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14C12Q1/68C12Q1/02C07K16/14G01N33/68A61K36/064A61K48/00A61K39/395A61P31/10C12R1/725
Inventor 陈江野刘晓艳聂鑫怡丁宇烽
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com