Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for genetic transformation of purple alfalfa chloroplast

An alfalfa and chloroplast technology, applied in the field of plant genetic engineering, can solve the problems of location effect, low expression of exogenous genes, and difficulty in co-transformation of multiple genes.

Inactive Publication Date: 2012-02-01
JILIN ACAD OF AGRI SCI
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, traditional transgenic technology is mainly based on nuclear genome transformation, and there are still some problems to be solved, such as low expression of exogenous genes or even silence, difficulty in co-transformation of multiple genes, position effect, and environmental safety risks.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for genetic transformation of purple alfalfa chloroplast
  • Method for genetic transformation of purple alfalfa chloroplast
  • Method for genetic transformation of purple alfalfa chloroplast

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] 1. A method for constructing an alfalfa chloroplast transformation vector.

[0031] a. Alfalfa 16S-trnI - trnA-23S fragment amplification

[0032] Primers P1 (5'-cactctgctgggccgacactgacac -3') and P2 (5'- cctggctgtctctgcactcctacct -3') were designed, using the total DNA of alfalfa as a template, amplified by polymerase chain reaction (PCR) with high-fidelity enzymes, and obtained 4087bp The 16S-trnI-trnA-23S fragment (see SEQ ID NO: 1); this fragment and use puv The large fragment of the pUC19 plasmid digested with II was connected. The ligation product was sequenced by Shanghai Jierui Biotechnology Co., Ltd., and the sequencing primers were P3 (5'- gcaactgttgggaagggc -3') and P4 (5'- caatacgcaaaccgcctc -3'). After confirming that the sequence was correct, it was named pUCMS.

[0033] b. Construction of alfalfa chloroplast transformation vector pXLW-Ms01

[0034] First, design primers P5 (5'-CAATCGCCCTGGGTGGGTTACACG-3') and P6 (5'-CTTGAT

[0035] CCACTTGGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for genetic transformation of purple alfalfa chloroplast. The method is characterized in that purple alfalfa leaves can be bombarded through a particle gun, the bombarded leaves are screened on a selective medium containing spectinomycin, the transgenic plant of the purple alfalfa chloroplast is obtained after three times screening. The invention is capable of providing a carrier and a method for chloroplast transformation of purple alfalfa and realizing the expression of green fluorescent protein in the purple alfalfa chloroplast.

Description

technical field [0001] The invention relates to the field of plant genetic engineering, and discloses a method for genetic transformation of alfalfa chloroplasts, through which the expression of green fluorescent protein in alfalfa chloroplasts is realized. Background technique [0002] With the development of biotechnology, plant transgenic technology has achieved world-renowned achievements. Many new varieties of genetically modified crops with improved traits, such as resistance to diseases and insect pests, resistance to herbicides, and high quality, have come out and been promoted one after another, which has brought a huge boost to agricultural development. However, traditional transgenic technology is mainly based on nuclear genome transformation, and there are still some problems to be solved, such as low expression of exogenous genes or even silence, difficulty in co-transformation of multiple genes, position effect, and environmental safety risks. The emergence of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H4/00A01H5/00
Inventor 邢少辰韦正乙林春晶刘艳芝王云鹏蔡勤安
Owner JILIN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com