Method for genetic transformation of purple alfalfa chloroplast
An alfalfa and chloroplast technology, applied in the field of plant genetic engineering, can solve the problems of location effect, low expression of exogenous genes, and difficulty in co-transformation of multiple genes.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] 1. A method for constructing an alfalfa chloroplast transformation vector.
[0031] a. Alfalfa 16S-trnI - trnA-23S fragment amplification
[0032] Primers P1 (5'-cactctgctgggccgacactgacac -3') and P2 (5'- cctggctgtctctgcactcctacct -3') were designed, using the total DNA of alfalfa as a template, amplified by polymerase chain reaction (PCR) with high-fidelity enzymes, and obtained 4087bp The 16S-trnI-trnA-23S fragment (see SEQ ID NO: 1); this fragment and use puv The large fragment of the pUC19 plasmid digested with II was connected. The ligation product was sequenced by Shanghai Jierui Biotechnology Co., Ltd., and the sequencing primers were P3 (5'- gcaactgttgggaagggc -3') and P4 (5'- caatacgcaaaccgcctc -3'). After confirming that the sequence was correct, it was named pUCMS.
[0033] b. Construction of alfalfa chloroplast transformation vector pXLW-Ms01
[0034] First, design primers P5 (5'-CAATCGCCCTGGGTGGGTTACACG-3') and P6 (5'-CTTGAT
[0035] CCACTTGGC...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com