Unlock instant, AI-driven research and patent intelligence for your innovation.
Reagent for detecting enterohemorrhagic escherichia coli by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for enterohemorrhagic escherichia coli
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A constant temperature amplification technology for Escherichia coli, which is applied in the field of reagents to achieve the effects of improving efficiency, improving cost performance and high sensitivity
Active Publication Date: 2013-04-17
USTAR BIOTECHNOLOGIES (HANGZHOU) CO LTD
View PDF4 Cites 1 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
According to the existing epidemiological investigation data, there are also sporadic cases in my country, and there are no reports of outbreaks.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
[0065] Use conventional physiological and biochemical methods to detect suspected colonies of Escherichia coli O157:H7, and then carry out the following cross-primer nucleic acid constant temperature amplification detection:
[0066] (1) Take 0.1 g of the sample to be tested and suspend it with 1 g of normal saline.
[0067] (2) Take 1 gram of sample for nucleic acid extraction.
[0068] (3) Cross-primer nucleic acid constant temperature amplification
[0069] The composition ratio of each component in the reaction system is as follows:
[0090] Use conventional physiological and biochemical methods to detect suspected colonies of Escherichia coli O157:H7, and then carry out the following cross-primer nucleic acid constant temperature amplification detection:
[0091] (1) Take 100 grams of the sample to be tested and crush it.
[0092] (2) Take 1 gram of sample for nucleic acid extraction.
[0093] (3) Cross-primer nucleic acid constant temperature amplification
[0105] The composition of Bst enzyme buffer is 20 mM Tris-HCl, 10 mM (NH 4 )2 SO 4 , 10 mM KCl, 2 mM MgSO 4 ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a reagent for detecting enterohemorrhagic escherichia coli by using a cross primer nucleic acid isothermal amplification technology, an amplification method and a detection method for enterohemorrhagic escherichia coli. Five primer group sequences are designed, namely 5'CAGTCGTACGGGGATGCAG, 5'TCAGCAGTCATTACATAAG, 5'GCTCTTGCCACAGACTGCGTC, 5'AGGTTCCGCTATGCGACAT and 5'GCTCTTGCCACAGACTGCGTCAGTTTCGCCATTCGTTGACTACTT. Aiming at the enterohemorrhagic escherichia coli O157:H7 bacteria, the defects in the prior art are overcome by the reagent, and a method for detecting the enterohemorrhagic escherichia coli quickly at low cost by using the cross primer nucleic acid isothermal amplification technology is provided.
Description
technical field [0001] The invention relates to a bacteria inspection technology, in particular to a reagent for detecting enterohaemorrhagic Escherichia coli O157:H7 using a cross-primer nucleic acid constant temperature amplification technology, an amplification method and a detection method. Background technique [0002] Enterohaemorrhagic Escherichia coli O157:H7 belongs to the genusEnterobacteriaceae and is the main serotype of enterohaemorrhagic Escherichia coli, which can cause hemorrhagic colitis. In 1982, in Oregon and Michigan, the United States, it was isolated and named from the feces of patients with food poisoning caused by eating hamburgers. According to the U.S. Centers for Disease Control (CDC) report, more than 20,000 cases of patients are found in the country every year. The death toll was 200-500, and it was discovered or caused outbreaks and epidemics in more than 20 countries in the five major states of the world. Since its discovery in 1982, the lar...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More