Anti-virus effect, implementation method and purpose of miRNA(ribose nucleic acid)
A kind of RNA virus and virus technology, applied in the direction of antiviral agents, etc., can solve the problems of unreported miRNA immune cell function regulation, affecting antiviral natural immunity, and unreported miRNA
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] Example 1: Up-regulation of miR-155 expression in macrophages by viral infection
[0076] Vesicular stomatitis virus (VSV, a single-stranded negative-sense RNA virus) and Sendai virus (SeV, an RNA virus of the genus Paramyxovirus) were purchased from the China Center for Type Culture Collection (CCTCC).
[0077] Mice (C57 strain, female, 4-6 weeks old, purchased from Shanghai Sipro-Bikay Experimental Animal Co., Ltd.) were intraperitoneally injected with broth (purchased from Sigma) 1ml / mouse, and washed the peritoneal cavity with PBS three days later, according to the literature The reported method was used to obtain primary peritoneal macrophages [Hou, J. et al., MicroRNA-146a feedback inhibits RIG-I-dependent Type I IFN production in macrophages by targeting TRAF6, IRAK1, and IRAK2. J Immunol. 2009; 183: 2150- 2158].
[0078] Will 2×10 5 Mouse peritoneal macrophages were cultured overnight in a 24-well plate containing 0.5 ml of complete medium (RPMI 1640 medium ...
Embodiment 2
[0093] Example 2: miR-155 inhibits the replication of vesicular stomatitis virus (VSV) in macrophages
[0094] The following sequences (synthesized by Shanghai Gemma Company) were used to make miR-155 highly expressed or inhibit the expression of miR-155 in mouse peritoneal macrophages:
[0095] miR-155: UUAAUGCUAAUCGUGAUAGGGGU (SEQ ID NO: 1);
[0096] Small RNA control: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 7, TT protruding at the 3′ end is a commonly used modification method in the synthesis of small RNA sequences, which has no effect on its function, mainly to stabilize nucleotides [Wilda, M. etc., Killing of leukemic cells with a BCR / ABL fusion gene by RNA interference (RNAi). Oncogene.2002; 21:5176-5124]);
[0097] miR-155 inhibitor: 2'-O-Me-ACCCCUAUCACGAUUAGCAUUAA (SEQ ID NO: 8); and
[0098] Inhibitor control: 2'-O-Me-CAGUACUUUUGUGUAGUACAA (SEQ ID NO: 9).
[0099] Prepare mouse peritoneal macrophages as described in Example 1, and use INTERFERin transfection reagent (P...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 