Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-virus effect, implementation method and purpose of miRNA(ribose nucleic acid)

A kind of RNA virus and virus technology, applied in the direction of antiviral agents, etc., can solve the problems of unreported miRNA immune cell function regulation, affecting antiviral natural immunity, and unreported miRNA

Active Publication Date: 2015-05-06
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there has been no report that miRNA can regulate or affect antiviral innate immunity, nor has it been reported that miRNA is involved in the regulation of immune cell function
However, there is no report on miR-155 regulation of antiviral innate immune response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-virus effect, implementation method and purpose of miRNA(ribose nucleic acid)
  • Anti-virus effect, implementation method and purpose of miRNA(ribose nucleic acid)
  • Anti-virus effect, implementation method and purpose of miRNA(ribose nucleic acid)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] Example 1: Up-regulation of miR-155 expression in macrophages by viral infection

[0076] Vesicular stomatitis virus (VSV, a single-stranded negative-sense RNA virus) and Sendai virus (SeV, an RNA virus of the genus Paramyxovirus) were purchased from the China Center for Type Culture Collection (CCTCC).

[0077] Mice (C57 strain, female, 4-6 weeks old, purchased from Shanghai Sipro-Bikay Experimental Animal Co., Ltd.) were intraperitoneally injected with broth (purchased from Sigma) 1ml / mouse, and washed the peritoneal cavity with PBS three days later, according to the literature The reported method was used to obtain primary peritoneal macrophages [Hou, J. et al., MicroRNA-146a feedback inhibits RIG-I-dependent Type I IFN production in macrophages by targeting TRAF6, IRAK1, and IRAK2. J Immunol. 2009; 183: 2150- 2158].

[0078] Will 2×10 5 Mouse peritoneal macrophages were cultured overnight in a 24-well plate containing 0.5 ml of complete medium (RPMI 1640 medium ...

Embodiment 2

[0093] Example 2: miR-155 inhibits the replication of vesicular stomatitis virus (VSV) in macrophages

[0094] The following sequences (synthesized by Shanghai Gemma Company) were used to make miR-155 highly expressed or inhibit the expression of miR-155 in mouse peritoneal macrophages:

[0095] miR-155: UUAAUGCUAAUCGUGAUAGGGGU (SEQ ID NO: 1);

[0096] Small RNA control: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 7, TT protruding at the 3′ end is a commonly used modification method in the synthesis of small RNA sequences, which has no effect on its function, mainly to stabilize nucleotides [Wilda, M. etc., Killing of leukemic cells with a BCR / ABL fusion gene by RNA interference (RNAi). Oncogene.2002; 21:5176-5124]);

[0097] miR-155 inhibitor: 2'-O-Me-ACCCCUAUCACGAUUAGCAUUAA (SEQ ID NO: 8); and

[0098] Inhibitor control: 2'-O-Me-CAGUACUUUUGUGUAGUACAA (SEQ ID NO: 9).

[0099] Prepare mouse peritoneal macrophages as described in Example 1, and use INTERFERin transfection reagent (P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to an anti-virus effect, an implementation method and a purpose of miRNA(ribose nucleic acid). The invention particularly relates to a purpose of tiny RNA molecule miR-155 to the preparation of compositions for preventing and / or treating virus infection, and an application method thereof. The miR-155 has the obviously improved expression in virus infected macrophage. In addition, the miR-155 can inhibit the virus duplication, so an anti-virus effect is realized. The miR-155 can be used for preparing medicine for effectively resisting virus (particularly the RNA virus) infection, so the clinic application prospects are realized.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine, and specifically relates to the antiviral effect, implementation method and application of a small RNA molecule—miR-155. Background technique [0002] A virus is a tiny particle composed of a nucleic acid (ribonucleic acid RNA or deoxyribonucleic acid DNA) as the core and a protein as the shell (capsid, capsid). The nucleic acid can be divided into single strands or double strands, linear or spherical . [0003] Viruses are the smallest biological pathogens, ranging from 20nm to 300nm: the largest of which are poxviruses, such as vaccinia virus, which is 300nm × 200nm, barely visible under an ordinary light microscope; medium-sized viruses, such as influenza virus, diameter 80-100nm; small viruses, such as Japanese encephalitis virus, are only 20nm in diameter and can only be seen under an electron microscope [Basic Virology, Mang Keqiang et al., Chemical Industry Press, 2005 No. 1 Ed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/711A61P31/14A61P31/20A61P31/18A61P31/16
Inventor 曹雪涛王品李楠
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY