Antibacterial protein and its coding gene, expression system, refolding system and application

An antibacterial protein, expression system technology, applied in application, antibacterial drugs, genetic engineering and other directions, can solve the problem that diseases are difficult to control fundamentally

Inactive Publication Date: 2012-04-18
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the 1990s, with the rapid development of the shrimp farming industry, the problem of disease has become increasingly apparent. The abuse of antibiotics and the deterioration of the environment have made it difficult to fundamentally control the disease of shrimp

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibacterial protein and its coding gene, expression system, refolding system and application
  • Antibacterial protein and its coding gene, expression system, refolding system and application
  • Antibacterial protein and its coding gene, expression system, refolding system and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1. A cloned Penaeus chinensis antibacterial protein gene with the following sequence:

[0034] (1) SEQ ID No 1 information (see Sequence Listing)

[0035] (a) Sequence characteristics:

[0036] *Length: 681 base pairs

[0037] *Type: Nucleic Acid

[0038] *Chain type: Double chain

[0039] *Topological structure: linear

[0040] (b) Molecular type: cDNA

[0041] (c) Assumption: No

[0042] (d) Antonym: No

[0043] (e) Original source: Fenneropena eus chinensis

[0044] (2) SEQ ID No. 2 information (see sequence listing)

[0045] (a) Sequence features

[0046] *Length: 154 amino acids

[0047] *Type: Amino acid

[0048] *Chain type: single chain

[0049] *Topological structure: linear

[0050] (b) Molecular type: protein

[0051] Sequence description: SEQ ID No.1

[0052] 1 tcgtagtgttatcgaggcagctcttatactggtccggtcgttttgcaatacatgtcaaga 60

[0053] 61 gagactacgtggcacacatttaactcaccctccgtacaATGCAGCAGGTACTGTATTCTG 120

[0054] M Q Q V L Y S 7

[0055] 1...

Embodiment 2

[0129] Example 2. In vitro recombinant expression, isolation and purification and biological activity analysis of the Carcinin gene of Penaeus chinensis:

[0130] 1. Construction of recombinant expression vector

[0131] Submit the gene Carcinin (SEQ ID No.1) to the signal peptide analysis software (http: / / www.cbs.dtu.dk / services / SignalP / ), and the analysis results show that the whole Carcinin protein (SEQ ID No.2) peptide There is a hydrophobic signal peptide at the N-terminus of the chain with a total of 20 amino acids (MQQVLYSALLWACLWNGVRS). The mature Carcinin protein that is secreted outside the cell does not contain a signal peptide. Therefore, a pair of specific primers (FcCar-F: 5'CAT GGA TCC CCGATC TAC GCC ACA GAA 3', 5'CAT GGA TCC CCGATC TAC GCC ACA GAA 3', a pair of specific primers introduced with two restriction sites were designed according to the cloned Penaeus chinensis Carcinin cDNA mature peptide coding sequence. Introduce BamH I restriction site GGA TCC at the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to Fenneropenaeus chinensis antibacterial protein and its coding gene, expression system, refolding system and application. The protein comprises amino acid sequences represented by SEQ ID No.2 in the sequence table or amino acid sequences represented by SEQ ID No.4 in the sequence table. The invention has the advantages that: a novel antibacterial protein Carcinin gene sequence is cloned from the Fenneropenaeus chinensis cDNA library, the Carcinin gene sequence encoding amino acid sequence is deduced; and the prokaryotic expressing system which is suitable for the recombinant expression in vitro of the antibacterial protein is screened out, thus the protein can be expressed efficiently, the recombinant protein can be refolded well, and the verification of biological functions of the recombinant protein shows that the recombinant protein has growth inhibitory effects on Grampositive bacteria and has no growth inhibitory effects on Gram negative bacteria. The clone and recombinant expression of the gene has an important application prospect in developing novel antibacterial drugs.

Description

Technical field [0001] The invention relates to the cloning, recombinant expression and biological activity analysis of the Carcinin gene of the antibacterial protein of Penaeus chinensis. Background technique [0002] Shrimp aquaculture is an important pillar industry in my country's coastal areas. With the continuous growth of market demand for high-quality aquatic products, shrimp aquaculture is occupying an increasingly important position in aquaculture. Since the 1990s, with the rapid development of the shrimp farming industry, disease problems have become increasingly apparent. The abuse of antibiotics and the deterioration of the environment have made it difficult to fundamentally control shrimp diseases. [0003] Marine invertebrates living in a water environment rich in various microorganisms form an effective defense function under long-term environmental pressure. However, the defense system of invertebrates is much simpler than that of higher animals, mainly relying on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12C12N15/70C12N1/21A61K38/17A61P31/04
Inventor桂朗王兵李富花相建海
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI