Primer set, rapid diagnostic kit and detection method used for detecting abalone shriveling syndrome associated virus
A technology for rapid diagnosis of Abalone muscular dystrophy, which is applied in the detection of Abalone muscular dystrophy virus, rapid diagnosis kits, and primer sets, and can solve problems such as great difficulty, so as to improve specificity, overcome long detection time, and identify easy effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Embodiment 1: Utilize LAMP to detect the preparation of the primer set of abalone muscular dystrophy virus
[0059] Abalone muscular dystrophy virus (AbSV) is a novel virus whose genome sequence (GenBank Accession Number EU350361) bears little similarity to known gene sequences. The Abalone muscular dystrophy virus was compared with the existing nucleic acid sequences in NCBI, and primers were selected for the segments in the EU350361 sequence that had no similarity with the existing nucleic acid sequences to ensure the specificity of the primers. Enter the EU350361 sequence in the system of http: / / primerexplorer.jp / e / , select the default parameters, and generate primers. Among them, the F3 primer is located at the 469-489 position of the EU350361 sequence; the B3 primer is located at the 660-639 position of the EU350361 sequence; the FIP primer is located at the 487-509 and 551-530 positions of the EU350361 sequence; the BIP primer is located at the 576-598 and 616- ...
Embodiment 2
[0069] A kit for the detection of abalone muscular dystrophy virus, comprising the following reagents:
[0070] a) Contain the primer set described in Example 1, which primer set includes an outer primer pair and an inner primer.
[0071] Among them, 10umol / L outer primer pair:
[0072] F3: TGCCTAAAATTCACACAAACT,
[0073] B3: ACAGACAAAATGTTTTTCATCG;
[0074] 10umol / L inner primer pair:
[0075] FIP: CCTTGTGGATCCAAGGCATACTGAACTACATGGTAACACCCA,
[0076] BIP: GCCTTTATTTGACTGGCAATTGGCTGTTTTTTCCGGAAAAATTTAGC.
[0077] b) Positive control substance: Abalone genomic DNA containing 0.2mg / mL Abalone muscular dystrophy virus.
[0078] c) LAMP reaction solution: containing 1× reaction buffer, 1.0mmol / LdNTPs, 1.0mol / L betaine and 1mmol / L MgSO 4 , the 1× reaction buffer contained 20mM Tris-HCl at pH 8.8, 10mmol / L KCl, 10mmol / L (NH4) 2 SO 4 , 2mmol / L MgSO 4 and 0.1% Triton X-100 as a percentage of the volume of the reaction buffer.
[0079] d) Bst DNA polymerase.
[0080] e) Chro...
Embodiment 3
[0083] The difference with embodiment 2 is:
[0084] b) Positive control substance: Abalone genomic DNA containing 0.1mg / mL Abalone muscular dystrophy virus.
[0085] c) LAMP reaction solution: containing 1× reaction buffer, 0.5mmol / LdNTPs, 0.5mol / L betaine and 2mmol / L MgSO 4 .
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 