Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer set, rapid diagnostic kit and detection method used for detecting abalone muscular atrophy associated virus

A rapid diagnosis technology for abalone muscular dystrophy, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/testing, etc., can solve very difficult problems, achieve specificity improvement, and operate quickly, conveniently and efficiently , the effect of easy identification

Inactive Publication Date: 2013-07-17
SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] For LAMP, the design of 4 specific primers is the key, and there are many requirements for primer design, such as the distance between each primer, Tm value and the stability of primer ends, etc., so it is very difficult to design four primers that meet the requirements from the target sequence of 200-300 bases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set, rapid diagnostic kit and detection method used for detecting abalone muscular atrophy associated virus
  • Primer set, rapid diagnostic kit and detection method used for detecting abalone muscular atrophy associated virus
  • Primer set, rapid diagnostic kit and detection method used for detecting abalone muscular atrophy associated virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1: Utilize LAMP to detect the preparation of the primer set of abalone muscular dystrophy virus

[0059] Abalone muscular dystrophy virus (AbSV) is a novel virus whose genome sequence (GenBank Accession Number EU350361) bears little similarity to known gene sequences. The Abalone muscular dystrophy virus was compared with the existing nucleic acid sequences in NCBI, and primers were selected for the segments in the EU350361 sequence that had no similarity with the existing nucleic acid sequences to ensure the specificity of the primers. Enter the EU350361 sequence in the system of http: / / primerexplorer.jp / e / , select the default parameters, and generate primers. Among them, the F3 primer is located at the 469-489 position of the EU350361 sequence; the B3 primer is located at the 660-639 position of the EU350361 sequence; the FIP primer is located at the 487-509 and 551-530 positions of the EU350361 sequence; the BIP primer is located at the 576-598 and 616- 6...

Embodiment 2

[0069] A kit for the detection of abalone muscular dystrophy virus, comprising the following reagents:

[0070] a) Contain the primer set described in Example 1, which primer set includes an outer primer pair and an inner primer.

[0071] Among them, 10umol / L outer primer pair:

[0072] F3: TGCCTAAAATTCACACAAACT,

[0073] B3: ACAGACAAAATGTTTTTCATCG;

[0074] 10umol / L inner primer pair:

[0075] FIP: CCTTGTGGATCCAAGGCATACTGAACTACATGGTAACACCCA,

[0076] BIP: GCCTTTATTTGACTGGCAATTGGCTGTTTTTTCCGGAAAAATTTAGC.

[0077] b) Positive control substance: Abalone genomic DNA containing 0.2mg / mL Abalone muscular dystrophy virus.

[0078] c) LAMP reaction solution: containing 1× reaction buffer, 1.0mmol / LdNTPs, 1.0mol / L betaine and 1mmol / L MgSO 4 , the 1× reaction buffer contained 20mM Tris-HCl at pH 8.8, 10mmol / L KCl, 10mmol / L (NH4) 2 SO 4 , 2mmol / L MgSO 4 and 0.1% Triton X-100 as a percentage of the volume of the reaction buffer.

[0079] d) Bst DNA polymerase.

[0080] e) Chro...

Embodiment 3

[0083] The difference with embodiment 2 is:

[0084] b) Positive control substance: Abalone genomic DNA containing 0.1mg / mL Abalone muscular dystrophy virus.

[0085] c) LAMP reaction solution: containing 1× reaction buffer, 0.5mmol / LdNTPs, 0.5mol / L betaine and 2mmol / L MgSO 4 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer set used in LAMP (1oop-mediated isothermal amplification) for detecting abalone shriveling syndrome associated virus (AbSV). The primer set is composed of an outer primer pair and an inner primer pair. The outer primer pair is that: F3: TGCCTAAAATTCACACAAACT, and B3: ACAGACAAAATGTTTTTCATCG; and the inner primer pair is that: FIP: CCTTGTGGATCCAAGGCATACTGAACTACATGGTAACACCCA, and BIP: GCCTTTATTTGACTGGCAATTGGCTGTTTTTCCGGAAAAATTTAGC. The invention also discloses a rapid diagnostic kit comprising the primer set, wherein the kit is used in LAMP for detecting AbSV. The invention also discloses a LAMP method for detecting AbSV, wherein the method employs the kit. According to the invention, background influences of the amplification reaction can be considerably reduced, and specificity of AbSV detection is greatly improved.

Description

technical field [0001] The invention relates to a primer set for detecting abalone muscular dystrophy virus, and also relates to a rapid diagnostic kit for detecting abalone muscular dystrophy virus and a detection method for abalone muscular dystrophy virus, belonging to the field of biotechnology. Background technique [0002] Abalone is a traditional and precious food material in China. Its meat is delicious and nutritious, and it is a marine economic shellfish widely cultivated all over the world. From 1999 to 2005, abalone farms in Fujian, Guangdong and other places generally broke out large-scale diseases. The main symptoms were muscle and mantle atrophy, and body color turned black. Abalone can be infected at any stage, which caused destruction to the abalone breeding industry in southern my country. sex blow. The pathogen of the disease was later identified as Abalone Shriveling syndrome associated Virus (AbSV). [0003] So far, there is no effective treatment for a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 姜敬哲张晗刘广锋王江勇
Owner SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI