Novel gene quantifying method

A gene quantity and gene technology, applied in the field of molecular biology, can solve problems such as not being able to enjoy the gospel of high-tech products, and achieve the effects of simplifying equipment investment, low cost, and simple calculation

Inactive Publication Date: 2012-06-27
李治国 +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these quantitative techniques require large-scale instruments and equipment. The price of a quantitative PCR instrument is more than ten times that of an ordinary PCR instrument. Therefore, relevant testing and research can only be carried out in large hospitals and scientific research institutes, and cannot Enjoy the gospel brought by this high-tech product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] (1) Escherichia coli oligodeoxynucleic acid primers were synthesized according to the following sequence:

[0014] ECFL: CTTCGCCACCGGTATTCC

[0015] ECBL: GGATTAGATACCCTGGTAGTCC

[0016] ECBIP: GCTCAGGTGCGAAAGCGTGGACCTCCAAGTCGACATCGTT

[0017] ECFIP: TCAGTCTTCGTCCAGGGGGCCAGGTGTAGCGGTGAAATGC

[0018] ECB3: CGTTAGCTCCGGAAGCCA

[0019] ECF3: TCTCGTAGAGGGGGGTAGA

[0020] (2) The preparation process is as follows:

[0021] Bst DNA polymerase 10 units / tube, 2mmol / L dNTP, 50mmol / L Tris-HCl, 20mmol / LKCl, 50mmol / L MgSO4, 0.5vol% TritonX-100, 1mmol / L betaine, 1mol / L HNB, Primer FIP / BIP1.6ummol / L, outer primer F3 / B30.2ummol / L, loop primer LB / LP0.4ummol / L.

[0022] The above substances were dissolved in 20ul of water.

[0023] (3) Detection of sensitivity and quantitative detection of unknown concentration:

[0024] a. Take the refrigerated HB101 Escherichia coli bacteria liquid and streak on the LB medium to isolate a single strain. Pick a single colony and inoculate it i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel gene quantifying method, which comprises the following steps of: (1) verifying the sensitivity of a group of amplification reagents through an experiment to detect a lowest gene quantity; (2) diluting templates to be quantified by different times and performing gene amplification on the templates of different concentrations with the same group of amplification reagents; and (3) calculating the quantity of genes to be quantified through a maximum diluting time which can be used for realizing gene amplification. In the method, only original gene amplification equipment is required, so that equipment investment is simplified greatly, the cost is low, and the method is suitable for basic level and field use; only one multiplication calculation is applied, and the multiplication calculation is simple and easy to learn; and the method has wide suitability, and can be combined with the conventional gene amplification technologies such as PCR (Polymerase Chain Reaction), LAMP (Loop-Mediated Isotheral Amplification), NASBA (Nucleic Acid Sequence Based Amplification) and the like for completing a quantifying process.

Description

[technical field] [0001] The present invention relates to the field of molecular biology, and more specifically, relates to a new gene quantification method. [Background technique] [0002] Gene amplification techniques including polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), nucleic acid sequence-dependent amplification (NASBA) and other technologies can specifically amplify extremely small amounts of target DNA by hundreds of 10,000 times, thus greatly improving the analysis and detection ability of DNA or RNA molecules, and can detect single molecule DNA or samples containing only 1 target DNA or RNA molecule per 100,000 cells, so this method has immediate application in molecular biology , microbiology, medicine and genetics and many other fields are widely used and developed rapidly. [0003] Due to the high sensitivity of gene amplification technology, there will be some false positives, and gene quantitative technology has emerged. Co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
Inventor李治国俞国华
Owner李治国